Rmu_co8479069.1_g000001

DnaJ molecular chaperone homology domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8479069.1
OG0014068
Physical Location & Seq
Forward (+)
1 .. 1532
1532 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8479069.1_g000001.1.cds

Sequence Viewer

Length: 748 bp
gcattgcaccagccctgttcgatcttcttcacctttcgtcgattggtatcgtcttcttggggtggaagaaacagctgggattcatgttgtaagaaagagataccatgaacttgctttacaacttcacccagataagaacaaccatgccaaggctgaatttgccttcaaacttgtctcagaggcatattcatgtctctctgatcatgaaaatagaagagcttttgacttggagagatggagcaagttctgctttgagtgtggtacaatcccctacacaacctacaagactcccagcaatgccaaggcttcagaacacaagggttggaatcccacaagcagttcgaggtcttgtaaagttatcaagggcctgaaagatatgagaaaccggtttagagaagaggcaagagtgatcgaaaactgtctgagggctaataatgcagcatcaagaaatgaatcctcgctcttcagtccaacttcttatatgtttcagagcaattctaatcctaggttgagcagggaaacccctgttttcaacccatctgatcatgtggttcaaggatatccccatgtcaggactcgaatttacgacaaagataaatctcggagcttttggtgcttgagaacagggcatcatatattgaattatgaacaaggaagggctagtagggctacatatgattctccagtatttgaggtcagatcagaaaggggaattttaaagagtagatctacttgtgttcgttcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ

Protein Analysis

248

Amino Acids

28.69

Weight (kDa)

9.58

Isoelectric Point (pI)

69.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014068)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G06778
fragaria_vesca FvH4_4g18890
malus_domestica MD13G1162300.v1.1 MD16G1162100.v1.1
prunus_persica Prupe.1G129600_v2.0.a1
pyrus_communis pycom13g13850 pycom16g13750
rosa_chinensis RchiOBHm_Chr4g0423791
rosa_multiflora Rmu_co8479069.1_g000001
rosa_roxburghii Rroxscaffold_5G00365900
rosa_rugosa Rorug04G0190600 Rorug04G0190700
rosa_samantha Rh4AG250100 Rh4BG255300 Rh4CG263300 Rh4DG249600
rosa_wichuraiana Rw4G021410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 156, 580, 712
AcuI CTGAAG 2 cut(s) 292, 449
AfaI GTAC 1 cut(s) 263
AfiI CCNNNNNNNGG 2 cut(s) 149, 571
AgeI ACCGGT 1 cut(s) 385
AgsI TTSAA 4 cut(s) 167, 533, 555, 641
AluBI AGCT 3 cut(s) 75, 219, 607
AluI AGCT 3 cut(s) 75, 219, 607
Alw26I GTCTC 2 cut(s) 179, 198
AoxI GGCC 1 cut(s) 365
ApeKI GCWGC 1 cut(s) 438
ApoI RAATTY 3 cut(s) 156, 580, 712
AsiGI ACCGGT 1 cut(s) 385
AspA2I CCTAGG 1 cut(s) 504
AspS9I GGNCC 1 cut(s) 365
AsuHPI GGTGA 2 cut(s) 22, 117
AvrII CCTAGG 1 cut(s) 504
BbsI GAAGAC 1 cut(s) 45
BbvI GCAGC 1 cut(s) 450
BccI CCATC 2 cut(s) 229, 545
BclI TGATCA 2 cut(s) 200, 542
BcoDI GTCTC 2 cut(s) 179, 198
BfaI CTAG 2 cut(s) 505, 661
BglII AGATCT 1 cut(s) 726
BisI GCNGC 1 cut(s) 439
BlnI CCTAGG 1 cut(s) 504
BlsI GCNGC 1 cut(s) 440
BmgT120I GGNCC 1 cut(s) 365
BmsI GCATC 2 cut(s) 450, 638
BpiI GAAGAC 1 cut(s) 45
BpmI CTGGAG 1 cut(s) 667
BpuEI CTTGAG 1 cut(s) 638
BsaBI GATNNNNATC 1 cut(s) 46
BsaJI CCNNGG 3 cut(s) 148, 301, 504
BsaWI WCCGGW 1 cut(s) 385
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 571
Bse118I RCCGGY 1 cut(s) 385
Bse1I ACTGG 1 cut(s) 684
Bse3DI GCAATG 1 cut(s) 302
Bse8I GATNNNNATC 1 cut(s) 46
BseDI CCNNGG 3 cut(s) 148, 301, 504
BseJI GATNNNNATC 1 cut(s) 46
BseLI CCNNNNNNNGG 2 cut(s) 149, 571
BseMI GCAATG 1 cut(s) 302
BseMII CTCAG 2 cut(s) 190, 414
BseNI ACTGG 1 cut(s) 684
BseXI GCAGC 1 cut(s) 450
BseYI CCCAGC 2 cut(s) 75, 291
BshFI GGCC 1 cut(s) 367
BshTI ACCGGT 1 cut(s) 385
BsiSI CCGG 1 cut(s) 386
BslI CCNNNNNNNGG 2 cut(s) 149, 571
BsmAI GTCTC 2 cut(s) 179, 198
BsnI GGCC 1 cut(s) 367
Bsp143I GATC 6 cut(s) 21, 200, 409, 542, 699, 726
BspANI GGCC 1 cut(s) 367
BspCNI CTCAG 2 cut(s) 189, 415
BspHI TCATGA 1 cut(s) 203
BspQI GCTCTTC 2 cut(s) 209, 468
BsrDI GCAATG 1 cut(s) 302
BsrFI RCCGGY 1 cut(s) 385
BsrI ACTGG 1 cut(s) 684
BssAI RCCGGY 1 cut(s) 385
BssECI CCNNGG 3 cut(s) 148, 301, 504
BssMI GATC 6 cut(s) 21, 200, 409, 542, 699, 726
BssT1I CCWWGG 3 cut(s) 148, 301, 504
Bst4CI ACNGT 1 cut(s) 420
Bst6I CTCTTC 3 cut(s) 209, 391, 468
BstAPI GCANNNNNTGC 1 cut(s) 247
BstDEI CTNAG 2 cut(s) 176, 423
BstKTI GATC 6 cut(s) 24, 203, 412, 545, 702, 729
BstMAI GTCTC 2 cut(s) 179, 198
BstMBI GATC 6 cut(s) 21, 200, 409, 542, 699, 726
BstMWI GCNNNNNNNGC 5 cut(s) 159, 247, 435, 613, 666
BstV1I GCAGC 1 cut(s) 450
BstV2I GAAGAC 1 cut(s) 45
BstX2I RGATCY 1 cut(s) 726
BstYI RGATCY 1 cut(s) 726
BsuRI GGCC 1 cut(s) 367
CciI TCATGA 1 cut(s) 203
Cfr10I RCCGGY 1 cut(s) 385
Cfr13I GGNCC 1 cut(s) 365
Csp6I GTAC 1 cut(s) 262
CspAI ACCGGT 1 cut(s) 385
CviAII CATG 7 cut(s) 84, 105, 144, 190, 204, 546, 567
CviQI GTAC 1 cut(s) 262
DdeI CTNAG 2 cut(s) 176, 423
DpnI GATC 6 cut(s) 23, 202, 411, 544, 701, 728
DpnII GATC 6 cut(s) 21, 200, 409, 542, 699, 726
DraI TTTAAA 1 cut(s) 718
Eam1104I CTCTTC 3 cut(s) 209, 391, 468
EarI CTCTTC 3 cut(s) 209, 391, 468
Eco130I CCWWGG 3 cut(s) 148, 301, 504
Eco32I GATATC 1 cut(s) 561
Eco57I CTGAAG 2 cut(s) 292, 449
EcoO109I RGGNCCY 1 cut(s) 365
EcoRV GATATC 1 cut(s) 561
EcoT14I CCWWGG 3 cut(s) 148, 301, 504
ErhI CCWWGG 3 cut(s) 148, 301, 504
FaeI CATG 7 cut(s) 87, 108, 147, 193, 207, 549, 570
FalI AAGNNNNNCTT 2 cut(s) 234, 266
FatI CATG 7 cut(s) 83, 104, 143, 189, 203, 545, 566
FauNDI CATATG 1 cut(s) 674
FbaI TGATCA 2 cut(s) 200, 542
Fnu4HI GCNGC 1 cut(s) 439
Fsp4HI GCNGC 1 cut(s) 439
FspBI CTAG 2 cut(s) 505, 661
GluI GCNGC 1 cut(s) 439
GsaI CCCAGC 2 cut(s) 79, 295
GsuI CTGGAG 1 cut(s) 667
HaeIII GGCC 1 cut(s) 367
HapII CCGG 1 cut(s) 386
Hin1II CATG 7 cut(s) 87, 108, 147, 193, 207, 549, 570
HinfI GANTC 6 cut(s) 80, 287, 326, 453, 575, 678
HpaII CCGG 1 cut(s) 386
HphI GGTGA 2 cut(s) 22, 117
Hpy188I TCNGA 9 cut(s) 179, 200, 311, 424, 490, 542, 604, 699, 704
Hpy188III TCNNGA 3 cut(s) 204, 445, 572
Hpy99I CGWCG 1 cut(s) 42
HpyAV CCTTC 2 cut(s) 173, 649
HpyCH4III ACNGT 1 cut(s) 420
HpyCH4V TGCA 2 cut(s) 7, 438
HpyF10VI GCNNNNNNNGC 5 cut(s) 159, 247, 435, 613, 666
HpyF3I CTNAG 2 cut(s) 176, 423
Hsp92II CATG 7 cut(s) 87, 108, 147, 193, 207, 549, 570
Ksp22I TGATCA 2 cut(s) 200, 542
Kzo9I GATC 6 cut(s) 21, 200, 409, 542, 699, 726
LguI GCTCTTC 2 cut(s) 209, 468
LmnI GCTCC 2 cut(s) 238, 604
Lsp1109I GCAGC 1 cut(s) 450
LweI GCATC 2 cut(s) 450, 638
MaeI CTAG 2 cut(s) 505, 661
MalI GATC 6 cut(s) 23, 202, 411, 544, 701, 728
MboI GATC 6 cut(s) 21, 200, 409, 542, 699, 726
MboII GAAGA 7 cut(s) 16, 19, 45, 78, 226, 408, 455
MflI RGATCY 1 cut(s) 726
MluCI AATT 5 cut(s) 156, 494, 580, 641, 712
MlyI GAGTC 2 cut(s) 281, 569
MmeI TCCRAC 2 cut(s) 303, 495
MnlI CCTC 6 cut(s) 173, 337, 392, 418, 467, 686
MseI TTAA 1 cut(s) 717
MslI CAYNNNNRTG 1 cut(s) 188
MspA1I CMGCKG 1 cut(s) 75
MspI CCGG 1 cut(s) 386
MwoI GCNNNNNNNGC 5 cut(s) 159, 247, 435, 613, 666
NdeI CATATG 1 cut(s) 674
NdeII GATC 6 cut(s) 21, 200, 409, 542, 699, 726
NlaIII CATG 7 cut(s) 87, 108, 147, 193, 207, 549, 570
PagI TCATGA 1 cut(s) 203
PciSI GCTCTTC 2 cut(s) 209, 468
PfeI GAWTC 4 cut(s) 80, 326, 453, 678
PinAI ACCGGT 1 cut(s) 385
PkrI GCNGC 1 cut(s) 440
PleI GAGTC 2 cut(s) 281, 569
PpsI GAGTC 2 cut(s) 281, 569
PspFI CCCAGC 2 cut(s) 75, 291
PspPI GGNCC 1 cut(s) 365
PsrI GAACNNNNNNTAC 2 cut(s) 100, 132
PsuI RGATCY 1 cut(s) 726
PvuII CAGCTG 1 cut(s) 75
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
RseI CAYNNNNRTG 1 cut(s) 188
SapI GCTCTTC 2 cut(s) 209, 468
SaqAI TTAA 1 cut(s) 717
SatI GCNGC 1 cut(s) 439
Sau3AI GATC 6 cut(s) 21, 200, 409, 542, 699, 726
Sau96I GGNCC 1 cut(s) 365
SchI GAGTC 2 cut(s) 281, 569
SetI ASST 8 cut(s) 35, 77, 221, 282, 348, 510, 609, 697
SfaNI GCATC 2 cut(s) 450, 638
SmiMI CAYNNNNRTG 1 cut(s) 188
SmlI CTYRAG 1 cut(s) 617
SmoI CTYRAG 1 cut(s) 617
Sse9I AATT 5 cut(s) 156, 494, 580, 641, 712
SspMI CTAG 2 cut(s) 505, 661
StyI CCWWGG 3 cut(s) 148, 301, 504
TaaI ACNGT 1 cut(s) 420
TaqI TCGA 5 cut(s) 20, 40, 342, 412, 578
TasI AATT 5 cut(s) 156, 494, 580, 641, 712
TfiI GAWTC 4 cut(s) 80, 326, 453, 678
Tru1I TTAA 1 cut(s) 717
Tru9I TTAA 1 cut(s) 717
TseI GCWGC 1 cut(s) 438
TspDTI ATGAA 6 cut(s) 72, 121, 178, 220, 466, 661
XapI RAATTY 3 cut(s) 156, 580, 712
XmaJI CCTAGG 1 cut(s) 504
XspI CTAG 2 cut(s) 505, 661
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.