Rmu_co8493293.1_g000001

ribosome biogenesis GTPase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8493293.1
OG0010219
Physical Location & Seq
Forward (+)
1 .. 2326
2326 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8493293.1_g000001.1.cds

Sequence Viewer

Length: 1088 bp
cgtcgtcgtcttctggatttcaggtggagctgctgtgtgtggtgagggcgttgttgaagaagataaagaggagagtgttggttggggacaaggtgctggtggggtccattgactgggtggaccgccggggaatgatcgagaatgtgtaccggaggagctccgagattcttgacccgccggtggccaatgtggaccatctgctcgtgcttttctctctggagcagcccaagcttgaccccttcgcgctcactaggtttctggttgaggccgagtccactggaattccactcactctggctctcaacaagtctgagctggttgacgaagagacaaaggctacatggaagtctaggctacataagtggggctacaagccactattatgcagcgttgaatctaaatctggactcgactctcttgcttttattttgagagatcaaacaagtgtaattgtgggtccaagtggagttggaaagtctagtctgatcaatgctttgaggaatagcgaccatcatgcttttgatgctgcagaagtggataatcggcttgatccaatttcaggcagcaagtggttggaggatcagcgtgttggagaggtttcagtaagaagtggtaaagggaagcataccactcgccacgtttccttgcttccattgtctggaggagggtatcttgctgatactcctgggttcagccagcctagtttaatgaaagtaacaaagcaatctctggcacaagctttccccgagatacagaagatactcaatgacagtgaagctgcgaaatgctcattcagtgactgcttgcatttgggtgaaaaaggttgcgttgtagggactgactgggaaagatacccgtactatttccaacttcttgatgagatcagaatcagagaggaatttcagttaaggacatttggaaccaaaaaagagggtgatgtaaggatcaaggatggacaagctgaaccaaggttggagcgtaagaagcataggagagtatctcgcaagagtatgaaccaatcagttctagatgaattagatgagcttgatgacgacgacaacgatttactagatgaggtgaaccgataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00730 ko01100 map00730 map01100
Pfam Domains
Protein Families
RsgA_GTPase

Protein Analysis

361

Amino Acids

40.53

Weight (kDa)

6.28

Isoelectric Point (pI)

37.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 113, 658
AccII CGCG 1 cut(s) 244
AciI CCGC 2 cut(s) 123, 175
AclWI GGATC 3 cut(s) 544, 587, 952
AcoI YGGCCR 1 cut(s) 182
AcsI RAATTY 2 cut(s) 281, 898
AfaI GTAC 2 cut(s) 148, 859
AfiI CCNNNNNNNGG 4 cut(s) 113, 180, 559, 658
AgsI TTSAA 2 cut(s) 57, 394
AjnI CCWGG 1 cut(s) 684
AluBI AGCT 8 cut(s) 30, 158, 231, 315, 739, 778, 961, 1044
AluI AGCT 8 cut(s) 30, 158, 231, 315, 739, 778, 961, 1044
Alw21I GWGCWC 1 cut(s) 160
Alw26I GTCTC 1 cut(s) 322
AlwI GGATC 3 cut(s) 544, 587, 952
AlwNI CAGNNNCTG 1 cut(s) 800
Ama87I CYCGRG 1 cut(s) 745
AoxI GGCC 2 cut(s) 182, 266
ApeKI GCWGC 6 cut(s) 30, 222, 386, 526, 563, 778
ApoI RAATTY 2 cut(s) 281, 898
AspLEI GCGC 1 cut(s) 246
AspS9I GGNCC 4 cut(s) 104, 120, 192, 457
AsuC2I CCSGG 1 cut(s) 127
AsuHPI GGTGA 3 cut(s) 54, 826, 946
AvaI CYCGRG 1 cut(s) 745
AvaII GGWCC 4 cut(s) 104, 120, 192, 457
BalI TGGCCA 1 cut(s) 184
BanII GRGCYC 1 cut(s) 160
BauI CACGAG 1 cut(s) 202
BbsI GAAGAC 1 cut(s) 2
Bbv12I GWGCWC 1 cut(s) 160
BbvI GCAGC 6 cut(s) 17, 234, 398, 513, 575, 765
BccI CCATC 3 cut(s) 203, 518, 946
BcgI CGANNNNNNTGC 6 cut(s) 400, 434, 496, 530, 613, 647
BciT130I CCWGG 1 cut(s) 686
BclI TGATCA 1 cut(s) 485
BcnI CCSGG 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 322
BfaI CTAG 6 cut(s) 251, 350, 479, 701, 1027, 1069
BfmI CTRYAG 1 cut(s) 527
BisI GCNGC 6 cut(s) 31, 223, 387, 527, 564, 779
BlsI GCNGC 6 cut(s) 32, 224, 388, 528, 565, 780
Bme1390I CCNGG 2 cut(s) 127, 686
Bme18I GGWCC 4 cut(s) 104, 120, 192, 457
BmeT110I CYCGRG 1 cut(s) 745
BmgT120I GGNCC 4 cut(s) 104, 120, 192, 457
BmiI GGNNCC 3 cut(s) 105, 458, 921
BmrFI CCNGG 2 cut(s) 127, 686
BmrI ACTGGG 2 cut(s) 123, 852
BmsI GCATC 1 cut(s) 513
BmuI ACTGGG 2 cut(s) 123, 852
BpiI GAAGAC 1 cut(s) 2
BplI GAGNNNNNCTC 2 cut(s) 984, 1016
BpmI CTGGAG 2 cut(s) 238, 680
BpuMI CCSGG 1 cut(s) 127
BsaBI GATNNNNATC 1 cut(s) 886
BsaJI CCNNGG 3 cut(s) 126, 685, 967
BsaWI WCCGGW 1 cut(s) 149
BsaXI ACNNNNNCTCC 2 cut(s) 19, 49
Bsc4I CCNNNNNNNGG 4 cut(s) 113, 180, 559, 658
Bse118I RCCGGY 1 cut(s) 177
Bse1I ACTGG 3 cut(s) 118, 282, 847
Bse8I GATNNNNATC 1 cut(s) 886
BseBI CCWGG 1 cut(s) 686
BseDI CCNNGG 3 cut(s) 126, 685, 967
BseGI GGATG 1 cut(s) 957
BseJI GATNNNNATC 1 cut(s) 886
BseLI CCNNNNNNNGG 4 cut(s) 113, 180, 559, 658
BseMII CTCAG 1 cut(s) 302
BseNI ACTGG 3 cut(s) 118, 282, 847
BseRI GAGGAG 3 cut(s) 84, 168, 677
BseXI GCAGC 6 cut(s) 17, 234, 398, 513, 575, 765
Bsh1236I CGCG 1 cut(s) 244
BshFI GGCC 2 cut(s) 184, 268
BsiHKAI GWGCWC 1 cut(s) 160
BsiHKCI CYCGRG 1 cut(s) 745
BsiSI CCGG 3 cut(s) 126, 150, 178
BslFI GGGAC 2 cut(s) 100, 849
BslI CCNNNNNNNGG 4 cut(s) 113, 180, 559, 658
BsmAI GTCTC 1 cut(s) 322
BsmFI GGGAC 2 cut(s) 100, 849
BsnI GGCC 2 cut(s) 184, 268
BsoBI CYCGRG 1 cut(s) 745
Bsp1286I GDGCHC 1 cut(s) 160
Bsp143I GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
BspACI CCGC 2 cut(s) 123, 175
BspANI GGCC 2 cut(s) 184, 268
BspCNI CTCAG 1 cut(s) 303
BspFNI CGCG 1 cut(s) 244
BspLI GGNNCC 3 cut(s) 105, 458, 921
BspMAI CTGCAG 1 cut(s) 531
BspPI GGATC 3 cut(s) 544, 587, 952
BsrFI RCCGGY 1 cut(s) 177
BsrI ACTGG 3 cut(s) 118, 282, 847
BssAI RCCGGY 1 cut(s) 177
BssECI CCNNGG 3 cut(s) 126, 685, 967
BssMI GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
BssSI CACGAG 1 cut(s) 202
BssT1I CCWWGG 1 cut(s) 967
Bst2BI CACGAG 1 cut(s) 202
Bst2UI CCWGG 1 cut(s) 686
Bst4CI ACNGT 1 cut(s) 772
Bst6I CTCTTC 1 cut(s) 320
BstC8I GCNNGC 2 cut(s) 697, 805
BstDEI CTNAG 1 cut(s) 311
BstF5I GGATG 1 cut(s) 957
BstFNI CGCG 1 cut(s) 244
BstHHI GCGC 1 cut(s) 246
BstKTI GATC 7 cut(s) 137, 438, 488, 552, 582, 884, 947
BstMAI GTCTC 1 cut(s) 322
BstMBI GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
BstMWI GCNNNNNNNGC 3 cut(s) 228, 523, 984
BstNI CCWGG 1 cut(s) 686
BstSCI CCNGG 2 cut(s) 125, 684
BstSFI CTRYAG 1 cut(s) 527
BstUI CGCG 1 cut(s) 244
BstV1I GCAGC 6 cut(s) 17, 234, 398, 513, 575, 765
BstV2I GAAGAC 1 cut(s) 2
BsuRI GGCC 2 cut(s) 184, 268
BtsCI GGATG 1 cut(s) 957
BtsIMutI CAGTG 3 cut(s) 275, 777, 801
Cac8I GCNNGC 2 cut(s) 697, 805
CaiI CAGNNNCTG 1 cut(s) 800
CfoI GCGC 1 cut(s) 246
Cfr10I RCCGGY 1 cut(s) 177
Cfr13I GGNCC 4 cut(s) 104, 120, 192, 457
Csp6I GTAC 2 cut(s) 147, 858
CviAII CATG 2 cut(s) 341, 514
CviQI GTAC 2 cut(s) 147, 858
DdeI CTNAG 1 cut(s) 311
DpnI GATC 7 cut(s) 136, 437, 487, 551, 581, 883, 946
DpnII GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
EaeI YGGCCR 1 cut(s) 182
Eam1104I CTCTTC 1 cut(s) 320
EarI CTCTTC 1 cut(s) 320
Ecl136II GAGCTC 1 cut(s) 158
Eco130I CCWWGG 1 cut(s) 967
Eco24I GRGCYC 1 cut(s) 160
Eco47I GGWCC 4 cut(s) 104, 120, 192, 457
Eco53kI GAGCTC 1 cut(s) 158
Eco88I CYCGRG 1 cut(s) 745
EcoICRI GAGCTC 1 cut(s) 158
EcoRI GAATTC 1 cut(s) 281
EcoRII CCWGG 1 cut(s) 684
EcoT14I CCWWGG 1 cut(s) 967
EcoT38I GRGCYC 1 cut(s) 160
ErhI CCWWGG 1 cut(s) 967
FaeI CATG 2 cut(s) 344, 517
FaiI YATR 7 cut(s) 342, 359, 384, 515, 626, 989, 1012
FaqI GGGAC 2 cut(s) 100, 849
FatI CATG 2 cut(s) 340, 513
FauI CCCGC 1 cut(s) 182
FbaI TGATCA 1 cut(s) 485
Fnu4HI GCNGC 6 cut(s) 31, 223, 387, 527, 564, 779
FokI GGATG 1 cut(s) 964
FriOI GRGCYC 1 cut(s) 160
Fsp4HI GCNGC 6 cut(s) 31, 223, 387, 527, 564, 779
FspBI CTAG 6 cut(s) 251, 350, 479, 701, 1027, 1069
GlaI GCGC 1 cut(s) 245
GluI GCNGC 6 cut(s) 31, 223, 387, 527, 564, 779
GsuI CTGGAG 2 cut(s) 238, 680
HaeIII GGCC 2 cut(s) 184, 268
HapII CCGG 3 cut(s) 126, 150, 178
HhaI GCGC 1 cut(s) 246
Hin1II CATG 2 cut(s) 344, 517
Hin6I GCGC 1 cut(s) 244
HinP1I GCGC 1 cut(s) 244
HincII GTYRAC 1 cut(s) 321
HindII GTYRAC 1 cut(s) 321
HindIII AAGCTT 2 cut(s) 229, 737
HinfI GANTC 6 cut(s) 165, 271, 394, 407, 412, 887
HpaII CCGG 3 cut(s) 126, 150, 178
HphI GGTGA 3 cut(s) 54, 826, 946
Hpy166II GTNNAC 6 cut(s) 120, 147, 192, 275, 321, 1080
Hpy188I TCNGA 5 cut(s) 162, 312, 485, 886, 892
Hpy188III TCNNGA 8 cut(s) 14, 138, 169, 217, 404, 659, 874, 1027
Hpy8I GTNNAC 6 cut(s) 120, 147, 192, 275, 321, 1080
Hpy99I CGWCG 2 cut(s) 9, 1057
HpyAV CCTTC 1 cut(s) 249
HpyCH4III ACNGT 1 cut(s) 772
HpyCH4IV ACGT 1 cut(s) 638
HpyCH4V TGCA 3 cut(s) 386, 529, 807
HpyF10VI GCNNNNNNNGC 3 cut(s) 228, 523, 984
HpyF3I CTNAG 1 cut(s) 311
HpySE526I ACGT 1 cut(s) 638
Hsp92II CATG 2 cut(s) 344, 517
HspAI GCGC 1 cut(s) 244
Ksp22I TGATCA 1 cut(s) 485
Kzo9I GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
LmnI GCTCC 5 cut(s) 27, 155, 163, 219, 975
Lsp1109I GCAGC 6 cut(s) 17, 234, 398, 513, 575, 765
LweI GCATC 1 cut(s) 513
MaeI CTAG 6 cut(s) 251, 350, 479, 701, 1027, 1069
MaeII ACGT 1 cut(s) 638
MaeIII GTNAC 2 cut(s) 714, 796
MalI GATC 7 cut(s) 136, 437, 487, 551, 581, 883, 946
MboI GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
MboII GAAGA 4 cut(s) 69, 72, 337, 768
MhlI GDGCHC 1 cut(s) 160
MlsI TGGCCA 1 cut(s) 184
MluCI AATT 5 cut(s) 281, 449, 554, 898, 1033
MluNI TGGCCA 1 cut(s) 184
MlyI GAGTC 3 cut(s) 280, 401, 406
MmeI TCCRAC 5 cut(s) 450, 554, 570, 891, 953
Mox20I TGGCCA 1 cut(s) 184
MscI TGGCCA 1 cut(s) 184
MseI TTAA 2 cut(s) 706, 907
MslI CAYNNNNRTG 2 cut(s) 381, 812
Msp20I TGGCCA 1 cut(s) 184
MspI CCGG 3 cut(s) 126, 150, 178
MspR9I CCNGG 2 cut(s) 127, 686
MvaI CCWGG 1 cut(s) 686
MvnI CGCG 1 cut(s) 244
MwoI GCNNNNNNNGC 3 cut(s) 228, 523, 984
NciI CCSGG 1 cut(s) 127
NdeII GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
NlaIII CATG 2 cut(s) 344, 517
NlaIV GGNNCC 3 cut(s) 105, 458, 921
NmeAIII GCCGAG 1 cut(s) 294
NmuCI GTSAC 1 cut(s) 796
PcsI WCGNNNNNNNCGW 1 cut(s) 1058
PfeI GAWTC 3 cut(s) 165, 394, 887
PflMI CCANNNNNTGG 2 cut(s) 113, 658
PkrI GCNGC 6 cut(s) 32, 224, 388, 528, 565, 780
PleI GAGTC 3 cut(s) 279, 401, 406
PpsI GAGTC 3 cut(s) 279, 401, 406
Psp124BI GAGCTC 1 cut(s) 160
Psp6I CCWGG 1 cut(s) 684
PspGI CCWGG 1 cut(s) 684
PspN4I GGNNCC 3 cut(s) 105, 458, 921
PspPI GGNCC 4 cut(s) 104, 120, 192, 457
PstI CTGCAG 1 cut(s) 531
PstNI CAGNNNCTG 1 cut(s) 800
RsaI GTAC 2 cut(s) 148, 859
RsaNI GTAC 2 cut(s) 147, 858
RseI CAYNNNNRTG 2 cut(s) 381, 812
SacI GAGCTC 1 cut(s) 160
SaqAI TTAA 2 cut(s) 706, 907
SatI GCNGC 6 cut(s) 31, 223, 387, 527, 564, 779
Sau3AI GATC 7 cut(s) 134, 435, 485, 549, 579, 881, 944
Sau96I GGNCC 4 cut(s) 104, 120, 192, 457
SchI GAGTC 3 cut(s) 280, 401, 406
ScrFI CCNGG 2 cut(s) 127, 686
SduI GDGCHC 1 cut(s) 160
SfaNI GCATC 1 cut(s) 513
SfcI CTRYAG 1 cut(s) 527
SgrAI CRCCGGYG 1 cut(s) 177
SinI GGWCC 4 cut(s) 104, 120, 192, 457
SmiMI CAYNNNNRTG 2 cut(s) 381, 812
Sse9I AATT 5 cut(s) 281, 449, 554, 898, 1033
SsiI CCGC 2 cut(s) 123, 175
SspMI CTAG 6 cut(s) 251, 350, 479, 701, 1027, 1069
SstI GAGCTC 1 cut(s) 160
StyD4I CCNGG 2 cut(s) 125, 684
StyI CCWWGG 1 cut(s) 967
TaaI ACNGT 1 cut(s) 772
TaiI ACGT 1 cut(s) 641
TaqI TCGA 2 cut(s) 137, 410
TasI AATT 5 cut(s) 281, 449, 554, 898, 1033
TfiI GAWTC 3 cut(s) 165, 394, 887
Tru1I TTAA 2 cut(s) 706, 907
Tru9I TTAA 2 cut(s) 706, 907
TscAI CASTG 3 cut(s) 282, 777, 801
TseFI GTSAC 1 cut(s) 796
TseI GCWGC 6 cut(s) 30, 222, 386, 526, 563, 778
Tsp45I GTSAC 1 cut(s) 796
TspDTI ATGAA 3 cut(s) 724, 1027, 1046
TspRI CASTG 3 cut(s) 282, 777, 801
Van91I CCANNNNNTGG 2 cut(s) 113, 658
VpaK11BI GGWCC 4 cut(s) 104, 120, 192, 457
XapI RAATTY 2 cut(s) 281, 898
XbaI TCTAGA 1 cut(s) 1026
XcmI CCANNNNNNNNNTGG 1 cut(s) 114
XspI CTAG 6 cut(s) 251, 350, 479, 701, 1027, 1069
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.