Rmu_co8495677.1_g000002

signal peptidase complex subunit 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8495677.1
OG0009961
Physical Location & Seq
Forward (+)
1667 .. 2210
544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8495677.1_g000002.1.cds

Sequence Viewer

Length: 312 bp
atggccaaccacgccgtgttcaggtcctctctggtttggttagcgctagttctcgtggttgttgggatttgcactcagtctttgaagaagatcatggtgacttacctggttggtgtgatcggaatcgggggtgtgcttttacctgattgggactactttgaccgggatttttcccggtggagttctccggttacggttgaggaaagggcctctgcgattgcaactgctgaaagatctggattagcaagggtcactcgtaatagcctgatgttaggggcaattgatcagttgagcttaacttggctctgctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SPC12

Protein Analysis

103

Amino Acids

11.33

Weight (kDa)

7.82

Isoelectric Point (pI)

42.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AdeI CACNNNGTG 1 cut(s) 16
AfeI AGCGCT 1 cut(s) 45
AfiI CCNNNNNNNGG 1 cut(s) 21
AgsI TTSAA 1 cut(s) 85
AjnI CCWGG 1 cut(s) 105
AluBI AGCT 1 cut(s) 294
AluI AGCT 1 cut(s) 294
Aor51HI AGCGCT 1 cut(s) 45
AoxI GGCC 2 cut(s) 3, 207
AspLEI GCGC 1 cut(s) 46
AspS9I GGNCC 2 cut(s) 24, 207
AsuC2I CCSGG 2 cut(s) 164, 175
AsuHPI GGTGA 1 cut(s) 109
AvaII GGWCC 1 cut(s) 24
BalI TGGCCA 1 cut(s) 5
BauI CACGAG 1 cut(s) 53
BciT130I CCWGG 1 cut(s) 107
BclI TGATCA 1 cut(s) 283
BcnI CCSGG 2 cut(s) 164, 175
BfaI CTAG 2 cut(s) 47, 310
BfoI RGCGCY 1 cut(s) 47
BglII AGATCT 1 cut(s) 233
Bme1390I CCNGG 3 cut(s) 107, 164, 175
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 2 cut(s) 24, 207
BmrFI CCNGG 3 cut(s) 107, 164, 175
BpuMI CCSGG 2 cut(s) 164, 175
BsaBI GATNNNNATC 1 cut(s) 122
BsaWI WCCGGW 1 cut(s) 187
Bsc4I CCNNNNNNNGG 1 cut(s) 21
Bse8I GATNNNNATC 1 cut(s) 122
BseBI CCWGG 1 cut(s) 107
BseJI GATNNNNATC 1 cut(s) 122
BseLI CCNNNNNNNGG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 89
BshFI GGCC 2 cut(s) 5, 209
BsiSI CCGG 3 cut(s) 163, 175, 188
BslFI GGGAC 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 21
BsmFI GGGAC 1 cut(s) 164
BsnI GGCC 2 cut(s) 5, 209
Bsp143I GATC 4 cut(s) 90, 117, 233, 283
BspANI GGCC 2 cut(s) 5, 209
BspCNI CTCAG 1 cut(s) 88
BssMI GATC 4 cut(s) 90, 117, 233, 283
BssSI CACGAG 1 cut(s) 53
Bst2BI CACGAG 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 107
Bst4CI ACNGT 1 cut(s) 196
BstDEI CTNAG 1 cut(s) 75
BstH2I RGCGCY 1 cut(s) 47
BstHHI GCGC 1 cut(s) 46
BstKTI GATC 4 cut(s) 93, 120, 236, 286
BstMBI GATC 4 cut(s) 90, 117, 233, 283
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 1 cut(s) 107
BstSCI CCNGG 3 cut(s) 105, 162, 173
BstX2I RGATCY 1 cut(s) 233
BstYI RGATCY 1 cut(s) 233
BsuRI GGCC 2 cut(s) 5, 209
CfoI GCGC 1 cut(s) 46
Cfr13I GGNCC 2 cut(s) 24, 207
CsiI ACCWGGT 1 cut(s) 105
CviAII CATG 1 cut(s) 94
CviJI RGCY 5 cut(s) 5, 209, 264, 294, 304
CviKI_1 RGCY 5 cut(s) 5, 209, 264, 294, 304
DdeI CTNAG 1 cut(s) 75
DpnI GATC 4 cut(s) 92, 119, 235, 285
DpnII GATC 4 cut(s) 90, 117, 233, 283
DraIII CACNNNGTG 1 cut(s) 16
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 24
Eco47III AGCGCT 1 cut(s) 45
EcoO109I RGGNCCY 2 cut(s) 24, 207
EcoRII CCWGG 1 cut(s) 105
FaeI CATG 1 cut(s) 97
FaiI YATR 1 cut(s) 95
FaqI GGGAC 1 cut(s) 164
FatI CATG 1 cut(s) 93
FbaI TGATCA 1 cut(s) 283
FspBI CTAG 2 cut(s) 47, 310
GlaI GCGC 1 cut(s) 45
HaeII RGCGCY 1 cut(s) 47
HaeIII GGCC 2 cut(s) 5, 209
HapII CCGG 3 cut(s) 163, 175, 188
HhaI GCGC 1 cut(s) 46
Hin1II CATG 1 cut(s) 97
Hin6I GCGC 1 cut(s) 44
HinP1I GCGC 1 cut(s) 44
HinfI GANTC 1 cut(s) 123
HpaII CCGG 3 cut(s) 163, 175, 188
HphI GGTGA 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 122
Hpy188III TCNNGA 1 cut(s) 237
HpyCH4III ACNGT 1 cut(s) 196
HpyCH4V TGCA 2 cut(s) 72, 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 75
Hsp92II CATG 1 cut(s) 97
HspAI GCGC 1 cut(s) 44
Ksp22I TGATCA 1 cut(s) 283
Kzo9I GATC 4 cut(s) 90, 117, 233, 283
MabI ACCWGGT 1 cut(s) 105
MaeI CTAG 2 cut(s) 47, 310
MaeIII GTNAC 3 cut(s) 97, 190, 250
MalI GATC 4 cut(s) 92, 119, 235, 285
MboI GATC 4 cut(s) 90, 117, 233, 283
MboII GAAGA 2 cut(s) 97, 100
MfeI CAATTG 1 cut(s) 279
MflI RGATCY 1 cut(s) 233
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 279
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 3 cut(s) 37, 193, 220
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 296
Msp20I TGGCCA 1 cut(s) 5
MspI CCGG 3 cut(s) 163, 175, 188
MspR9I CCNGG 3 cut(s) 107, 164, 175
MunI CAATTG 1 cut(s) 279
MvaI CCWGG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 11
NciI CCSGG 2 cut(s) 164, 175
NdeII GATC 4 cut(s) 90, 117, 233, 283
NlaIII CATG 1 cut(s) 97
NmuCI GTSAC 2 cut(s) 97, 250
PfeI GAWTC 1 cut(s) 123
PpuMI RGGWCCY 1 cut(s) 24
Psp5II RGGWCCY 1 cut(s) 24
Psp6I CCWGG 1 cut(s) 105
PspGI CCWGG 1 cut(s) 105
PspPI GGNCC 2 cut(s) 24, 207
PspPPI RGGWCCY 1 cut(s) 24
PsuI RGATCY 1 cut(s) 233
SaqAI TTAA 1 cut(s) 296
Sau3AI GATC 4 cut(s) 90, 117, 233, 283
Sau96I GGNCC 2 cut(s) 24, 207
ScrFI CCNGG 3 cut(s) 107, 164, 175
SetI ASST 4 cut(s) 26, 108, 145, 296
SexAI ACCWGGT 1 cut(s) 105
SinI GGWCC 1 cut(s) 24
Sse9I AATT 1 cut(s) 279
SspMI CTAG 2 cut(s) 47, 310
StyD4I CCNGG 3 cut(s) 105, 162, 173
TaaI ACNGT 1 cut(s) 196
TasI AATT 1 cut(s) 279
TfiI GAWTC 1 cut(s) 123
Tru1I TTAA 1 cut(s) 296
Tru9I TTAA 1 cut(s) 296
TseFI GTSAC 2 cut(s) 97, 250
Tsp45I GTSAC 2 cut(s) 97, 250
VpaK11BI GGWCC 1 cut(s) 24
XspI CTAG 2 cut(s) 47, 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.