Rmu_co8497659.1_g000001

Bifunctional protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8497659.1
Physical Location & Seq
Reverse (-)
2 .. 2304
2303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8497659.1_g000001.1.cds

Sequence Viewer

Length: 862 bp
atgcttaccatagcccatgagcagactgctgctgttattgatgggaagtctatcgcggacgatattaggtcaagaatagggagtgaggtaaggaggatgaaagagagcattggaatggtgcctgggttgggtgtaattatggttggtcagagaaaggactctgagacttatgtccggaacaagatgatggcttgtgaagaagttggaatcaaatcaaatgtggctcacctgcctgagcattgtacaaaagatcagcttcttaaagcattgtcaaagtttgatgtggatccctctgttcatggtattctcgtgcaacttcctctaccacaacatttggatgagagaaaaattatggatgtgctgagtccagagaaagatgtggatggcttccatccaattaatatgggaaatcttgccatgagaggaagggagcctatgtttattccatgcactccaaagggttgcattgagttgttgctcaggtctggcgtggaaatcgttgggaagaaagctgctgtcattggcagaagtaatattgtaggattacctacatcgttgcttttgcagaggcaccatgcaacagtcagcattgtacatgcattcacaaagaacccagaacatatcacctgtgaagctgacattgtggtcacagctgcaggagtgcctaatcttgtccgtggaaattggctaaaacctggagcagttgtcatcgacgttgggaccaatccagttgaggaccctagctgtgagcgaggttatcgcctcataggagatgtttgctatgaagaagcagtgcgggtggtgtcagccattaccccagttcctggaggagttggacccatgacaattgctatgcttctat

Protein Analysis

287

Amino Acids

31.05

Weight (kDa)

6.55

Isoelectric Point (pI)

38.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 237
AasI GACNNNNNNGTC 1 cut(s) 644
Acc36I ACCTGC 1 cut(s) 237
AccB1I GGYRCC 2 cut(s) 118, 570
AccB7I CCANNNNNTGG 1 cut(s) 824
AccII CGCG 1 cut(s) 56
AccIII TCCGGA 1 cut(s) 174
AciI CCGC 2 cut(s) 56, 796
AclWI GGATC 2 cut(s) 281, 294
AfaI GTAC 2 cut(s) 244, 594
AfiI CCNNNNNNNGG 2 cut(s) 128, 824
AjnI CCWGG 3 cut(s) 121, 694, 823
AluBI AGCT 5 cut(s) 256, 512, 635, 653, 744
AluI AGCT 5 cut(s) 256, 512, 635, 653, 744
Alw26I GTCTC 1 cut(s) 158
AlwI GGATC 2 cut(s) 281, 294
AlwNI CAGNNNCTG 1 cut(s) 824
Aor13HI TCCGGA 1 cut(s) 174
ApeKI GCWGC 3 cut(s) 29, 512, 653
AseI ATTAAT 1 cut(s) 399
AspS9I GGNCC 3 cut(s) 720, 736, 836
AsuHPI GGTGA 2 cut(s) 218, 616
AvaII GGWCC 3 cut(s) 720, 736, 836
BamHI GGATCC 1 cut(s) 286
BanI GGYRCC 2 cut(s) 118, 570
BauI CACGAG 1 cut(s) 308
BbvI GCAGC 3 cut(s) 16, 499, 640
BccI CCATC 4 cut(s) 35, 181, 377, 399
BciT130I CCWGG 3 cut(s) 123, 696, 825
BcoDI GTCTC 1 cut(s) 158
BfaI CTAG 1 cut(s) 741
BfmI CTRYAG 1 cut(s) 654
BfuAI ACCTGC 1 cut(s) 237
BisI GCNGC 3 cut(s) 30, 513, 654
BlsI GCNGC 3 cut(s) 31, 514, 655
Bme1390I CCNGG 3 cut(s) 123, 696, 825
Bme18I GGWCC 3 cut(s) 720, 736, 836
BmgT120I GGNCC 3 cut(s) 720, 736, 836
BmiI GGNNCC 7 cut(s) 120, 288, 432, 572, 721, 738, 838
BmrFI CCNGG 3 cut(s) 123, 696, 825
BmrI ACTGGG 1 cut(s) 812
BmuI ACTGGG 1 cut(s) 812
BoxI GACNNNNGTC 1 cut(s) 170
BpmI CTGGAG 2 cut(s) 717, 846
Bpu10I CCTNAGC 2 cut(s) 234, 479
BsaBI GATNNNNATC 1 cut(s) 285
BsaJI CCNNGG 2 cut(s) 122, 676
BsaWI WCCGGW 1 cut(s) 174
BsaXI ACNNNNNCTCC 4 cut(s) 422, 452, 690, 720
Bsc4I CCNNNNNNNGG 2 cut(s) 128, 824
Bse1I ACTGG 2 cut(s) 728, 818
Bse8I GATNNNNATC 1 cut(s) 285
BseAI TCCGGA 1 cut(s) 174
BseBI CCWGG 3 cut(s) 123, 696, 825
BseDI CCNNGG 2 cut(s) 122, 676
BseGI GGATG 5 cut(s) 102, 343, 361, 388, 391
BseJI GATNNNNATC 1 cut(s) 285
BseLI CCNNNNNNNGG 2 cut(s) 128, 824
BseMII CTCAG 4 cut(s) 153, 225, 353, 493
BseNI ACTGG 2 cut(s) 728, 818
BseRI GAGGAG 1 cut(s) 843
BseXI GCAGC 3 cut(s) 16, 499, 640
Bsh1236I CGCG 1 cut(s) 56
BshNI GGYRCC 2 cut(s) 118, 570
BsiSI CCGG 1 cut(s) 175
BslFI GGGAC 1 cut(s) 733
BslI CCNNNNNNNGG 2 cut(s) 128, 824
BsmAI GTCTC 1 cut(s) 158
BsmFI GGGAC 1 cut(s) 733
BsmI GAATGC 1 cut(s) 599
Bsp13I TCCGGA 1 cut(s) 174
Bsp1407I TGTACA 2 cut(s) 242, 592
Bsp143I GATC 2 cut(s) 250, 286
BspACI CCGC 2 cut(s) 56, 796
BspCNI CTCAG 4 cut(s) 154, 226, 354, 492
BspEI TCCGGA 1 cut(s) 174
BspFNI CGCG 1 cut(s) 56
BspLI GGNNCC 7 cut(s) 120, 288, 432, 572, 721, 738, 838
BspMAI CTGCAG 1 cut(s) 658
BspMI ACCTGC 1 cut(s) 237
BspPI GGATC 2 cut(s) 281, 294
BspT107I GGYRCC 2 cut(s) 118, 570
BsrGI TGTACA 2 cut(s) 242, 592
BsrI ACTGG 2 cut(s) 728, 818
BssECI CCNNGG 2 cut(s) 122, 676
BssMI GATC 2 cut(s) 250, 286
BssSI CACGAG 1 cut(s) 308
Bst2BI CACGAG 1 cut(s) 308
Bst2UI CCWGG 3 cut(s) 123, 696, 825
Bst4CI ACNGT 1 cut(s) 583
BstAUI TGTACA 2 cut(s) 242, 592
BstDEI CTNAG 4 cut(s) 162, 234, 362, 479
BstDSI CCRYGG 1 cut(s) 676
BstF5I GGATG 5 cut(s) 102, 343, 361, 388, 391
BstFNI CGCG 1 cut(s) 56
BstKTI GATC 2 cut(s) 253, 289
BstMAI GTCTC 1 cut(s) 158
BstMBI GATC 2 cut(s) 250, 286
BstNI CCWGG 3 cut(s) 123, 696, 825
BstNSI RCATGY 1 cut(s) 599
BstPAI GACNNNNGTC 1 cut(s) 170
BstSCI CCNGG 3 cut(s) 121, 694, 823
BstSFI CTRYAG 1 cut(s) 654
BstUI CGCG 1 cut(s) 56
BstV1I GCAGC 3 cut(s) 16, 499, 640
BstX2I RGATCY 1 cut(s) 286
BstYI RGATCY 1 cut(s) 286
BtgI CCRYGG 1 cut(s) 676
BtsCI GGATG 5 cut(s) 102, 343, 361, 388, 391
BtsI GCAGTG 1 cut(s) 798
BtsIMutI CAGTG 1 cut(s) 798
BveI ACCTGC 1 cut(s) 237
CaiI CAGNNNCTG 1 cut(s) 824
Cfr13I GGNCC 3 cut(s) 720, 736, 836
Csp6I GTAC 2 cut(s) 243, 593
CspCI CAANNNNNGTGG 2 cut(s) 315, 350
CviAII CATG 7 cut(s) 17, 299, 418, 447, 575, 596, 841
CviQI GTAC 2 cut(s) 243, 593
DdeI CTNAG 4 cut(s) 162, 234, 362, 479
DpnI GATC 2 cut(s) 252, 288
DpnII GATC 2 cut(s) 250, 286
DrdI GACNNNNNNGTC 1 cut(s) 644
DseDI GACNNNNNNGTC 1 cut(s) 644
Eco47I GGWCC 3 cut(s) 720, 736, 836
EcoO109I RGGNCCY 1 cut(s) 736
EcoRII CCWGG 3 cut(s) 121, 694, 823
EcoT22I ATGCAT 1 cut(s) 601
FaeI CATG 7 cut(s) 20, 302, 421, 450, 578, 599, 844
FalI AAGNNNNNCTT 2 cut(s) 240, 272
FaqI GGGAC 1 cut(s) 733
FatI CATG 7 cut(s) 16, 298, 417, 446, 574, 595, 840
FauI CCCGC 1 cut(s) 789
Fnu4HI GCNGC 3 cut(s) 30, 513, 654
FokI GGATG 5 cut(s) 109, 350, 368, 378, 395
Fsp4HI GCNGC 3 cut(s) 30, 513, 654
FspBI CTAG 1 cut(s) 741
GluI GCNGC 3 cut(s) 30, 513, 654
GsuI CTGGAG 2 cut(s) 717, 846
HapII CCGG 1 cut(s) 175
Hin1II CATG 7 cut(s) 20, 302, 421, 450, 578, 599, 844
HinfI GANTC 3 cut(s) 158, 207, 364
HpaII CCGG 1 cut(s) 175
HphI GGTGA 2 cut(s) 218, 616
Hpy188I TCNGA 2 cut(s) 150, 163
Hpy188III TCNNGA 3 cut(s) 72, 175, 368
Hpy99I CGWCG 1 cut(s) 716
HpyAV CCTTC 1 cut(s) 420
HpyCH4III ACNGT 1 cut(s) 583
HpyCH4IV ACGT 1 cut(s) 714
HpyCH4V TGCA 7 cut(s) 313, 450, 465, 565, 578, 599, 656
HpyF3I CTNAG 4 cut(s) 162, 234, 362, 479
HpySE526I ACGT 1 cut(s) 714
Hsp92II CATG 7 cut(s) 20, 302, 421, 450, 578, 599, 844
Kpn2I TCCGGA 1 cut(s) 174
Kzo9I GATC 2 cut(s) 250, 286
LmnI GCTCC 2 cut(s) 430, 698
Lsp1109I GCAGC 3 cut(s) 16, 499, 640
MaeI CTAG 1 cut(s) 741
MaeII ACGT 1 cut(s) 714
MaeIII GTNAC 1 cut(s) 646
MalI GATC 2 cut(s) 252, 288
MboI GATC 2 cut(s) 250, 286
MboII GAAGA 3 cut(s) 209, 517, 797
MfeI CAATTG 1 cut(s) 846
MflI RGATCY 1 cut(s) 286
MluCI AATT 5 cut(s) 135, 348, 396, 682, 846
MlyI GAGTC 2 cut(s) 152, 373
MmeI TCCRAC 2 cut(s) 184, 814
Mph1103I ATGCAT 1 cut(s) 601
MroI TCCGGA 1 cut(s) 174
MseI TTAA 2 cut(s) 261, 399
MslI CAYNNNNRTG 2 cut(s) 113, 336
MspA1I CMGCKG 1 cut(s) 653
MspI CCGG 1 cut(s) 175
MspR9I CCNGG 3 cut(s) 123, 696, 825
MunI CAATTG 1 cut(s) 846
Mva1269I GAATGC 1 cut(s) 599
MvaI CCWGG 3 cut(s) 123, 696, 825
MvnI CGCG 1 cut(s) 56
NdeII GATC 2 cut(s) 250, 286
NlaIII CATG 7 cut(s) 20, 302, 421, 450, 578, 599, 844
NlaIV GGNNCC 7 cut(s) 120, 288, 432, 572, 721, 738, 838
NmuCI GTSAC 1 cut(s) 646
NsiI ATGCAT 1 cut(s) 601
NspI RCATGY 1 cut(s) 599
PaqCI CACCTGC 1 cut(s) 237
PctI GAATGC 1 cut(s) 599
PfeI GAWTC 1 cut(s) 207
PflMI CCANNNNNTGG 1 cut(s) 824
PfoI TCCNGGA 1 cut(s) 823
PkrI GCNGC 3 cut(s) 31, 514, 655
PleI GAGTC 2 cut(s) 152, 372
PpsI GAGTC 2 cut(s) 152, 372
PpuMI RGGWCCY 1 cut(s) 736
PshAI GACNNNNGTC 1 cut(s) 170
PshBI ATTAAT 1 cut(s) 399
Psp5II RGGWCCY 1 cut(s) 736
Psp6I CCWGG 3 cut(s) 121, 694, 823
PspGI CCWGG 3 cut(s) 121, 694, 823
PspN4I GGNNCC 7 cut(s) 120, 288, 432, 572, 721, 738, 838
PspPI GGNCC 3 cut(s) 720, 736, 836
PspPPI RGGWCCY 1 cut(s) 736
PstI CTGCAG 1 cut(s) 658
PstNI CAGNNNCTG 1 cut(s) 824
PsuI RGATCY 1 cut(s) 286
PvuII CAGCTG 1 cut(s) 653
RsaI GTAC 2 cut(s) 244, 594
RsaNI GTAC 2 cut(s) 243, 593
RseI CAYNNNNRTG 2 cut(s) 113, 336
SaqAI TTAA 2 cut(s) 261, 399
SatI GCNGC 3 cut(s) 30, 513, 654
Sau3AI GATC 2 cut(s) 250, 286
Sau96I GGNCC 3 cut(s) 720, 736, 836
SchI GAGTC 2 cut(s) 152, 373
ScrFI CCNGG 3 cut(s) 123, 696, 825
SfcI CTRYAG 1 cut(s) 654
SinI GGWCC 3 cut(s) 720, 736, 836
SmiMI CAYNNNNRTG 2 cut(s) 113, 336
Sse9I AATT 5 cut(s) 135, 348, 396, 682, 846
SsiI CCGC 2 cut(s) 56, 796
SspI AATATT 1 cut(s) 535
SspMI CTAG 1 cut(s) 741
StyD4I CCNGG 3 cut(s) 121, 694, 823
TaaI ACNGT 1 cut(s) 583
TaiI ACGT 1 cut(s) 717
TaqI TCGA 1 cut(s) 711
TasI AATT 5 cut(s) 135, 348, 396, 682, 846
TatI WGTACW 2 cut(s) 242, 592
TfiI GAWTC 1 cut(s) 207
Tru1I TTAA 2 cut(s) 261, 399
Tru9I TTAA 2 cut(s) 261, 399
TscAI CASTG 1 cut(s) 798
TseFI GTSAC 1 cut(s) 646
TseI GCWGC 3 cut(s) 29, 512, 653
Tsp45I GTSAC 1 cut(s) 646
TspDTI ATGAA 3 cut(s) 113, 287, 798
TspGWI ACGGA 1 cut(s) 665
TspRI CASTG 1 cut(s) 798
Van91I CCANNNNNTGG 1 cut(s) 824
VpaK11BI GGWCC 3 cut(s) 720, 736, 836
VspI ATTAAT 1 cut(s) 399
XceI RCATGY 1 cut(s) 599
XspI CTAG 1 cut(s) 741
Zsp2I ATGCAT 1 cut(s) 601
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.