Rmu_co8507677.1_g000001

Cytochrome c-type biogenesis ccda-like chloroplastic protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8507677.1
Physical Location & Seq
Forward (+)
41 .. 2844
2804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8507677.1_g000001.1.cds

Sequence Viewer

Length: 885 bp
atgaatttggctatcaaccattgcggcagttacagcattaacaattctttcaccacttcaagctggaagcgtggccggaaaactagtcatggtagatatacggtgcccatcggagagctgaagggccattctacacctcagaatgttggccaagattttgcaccactggcaaagaatgatggaagcagcagctttcaaatgaagacgtttgtaaatgccatagcagtgggaaatttggtcttcacagacatggcaaaggctgtaactactgggaatatcctggaaggtgctgtatcagtttatgacattgctgaaggaggagctggagattggtttggaggcttcctatttactactggacaacaagctaatgaagctgttcaagaccagttatcagccctcagtttctccagtttggcagttatttttggtgctgggcttgttactagcctttctccttgtactcttagcgttctaccactgacccttggttacataggagcatttggttcagggaaaagcagggcacaggttattggggattcaattgcgttctcattaggattggcaactacacttgcactcttaggcattgcagcctcatttgctggaaaggcatatggacagacagggcagggattaccagtggctgcttcaggtttagctattgttatgggcttgaatctccttgagataattgaactacagctgccatccttttttgacaactttgatccccgggctgctgctgctaattttccatcaagtgtgcaagcttatctagctggacttacatttgctttagcagcctctccatgcagtacgccagtgctggccactctgctaggatatgttgctacgtccaaggtaaatttgaatgtttga

Protein Analysis

294

Amino Acids

30.22

Weight (kDa)

6.27

Isoelectric Point (pI)

27.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012312)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 103
AciI CCGC 1 cut(s) 24
AclWI GGATC 1 cut(s) 728
AcoI YGGCCR 3 cut(s) 73, 148, 834
AcsI RAATTY 3 cut(s) 4, 232, 871
AcuI CTGAAG 3 cut(s) 140, 333, 639
AfaI GTAC 2 cut(s) 463, 823
AgsI TTSAA 7 cut(s) 60, 197, 383, 546, 682, 701, 877
AhlI ACTAGT 1 cut(s) 83
AjnI CCWGG 1 cut(s) 279
AlwI GGATC 1 cut(s) 728
AlwNI CAGNNNCTG 1 cut(s) 650
Ama87I CYCGRG 1 cut(s) 738
AoxI GGCC 4 cut(s) 73, 124, 148, 834
ApeKI GCWGC 9 cut(s) 186, 189, 596, 650, 709, 743, 746, 749, 806
ApoI RAATTY 3 cut(s) 4, 232, 871
Asp700I GAANNNNTTC 1 cut(s) 378
AspS9I GGNCC 1 cut(s) 124
AsuC2I CCSGG 2 cut(s) 739, 740
AsuHPI GGTGA 1 cut(s) 43
AvaI CYCGRG 1 cut(s) 738
BaeGI GKGCMC 2 cut(s) 108, 529
BalI TGGCCA 2 cut(s) 150, 836
BanI GGYRCC 1 cut(s) 103
BbsI GAAGAC 2 cut(s) 209, 232
BbvI GCAGC 9 cut(s) 198, 201, 608, 637, 696, 730, 733, 736, 818
BccI CCATC 4 cut(s) 116, 173, 721, 769
BciT130I CCWGG 1 cut(s) 281
BcnI CCSGG 2 cut(s) 739, 740
BcuI ACTAGT 1 cut(s) 83
BfaI CTAG 4 cut(s) 84, 447, 782, 845
BfmI CTRYAG 1 cut(s) 704
Bme1390I CCNGG 3 cut(s) 281, 739, 740
BmeT110I CYCGRG 1 cut(s) 738
BmgT120I GGNCC 1 cut(s) 124
BmiI GGNNCC 1 cut(s) 105
BmrFI CCNGG 3 cut(s) 281, 739, 740
BmrI ACTGGG 1 cut(s) 279
BmuI ACTGGG 1 cut(s) 279
BpiI GAAGAC 2 cut(s) 209, 232
BpmI CTGGAG 2 cut(s) 345, 394
BpuEI CTTGAG 1 cut(s) 710
BpuMI CCSGG 2 cut(s) 739, 740
BsaJI CCNNGG 4 cut(s) 487, 737, 738, 864
Bse1I ACTGG 7 cut(s) 171, 274, 361, 388, 411, 644, 827
Bse3DI GCAATG 3 cut(s) 19, 306, 591
BseBI CCWGG 1 cut(s) 281
BseDI CCNNGG 4 cut(s) 487, 737, 738, 864
BseGI GGATG 1 cut(s) 713
BseMI GCAATG 3 cut(s) 19, 306, 591
BseMII CTCAG 2 cut(s) 152, 415
BseNI ACTGG 7 cut(s) 171, 274, 361, 388, 411, 644, 827
BseRI GAGGAG 1 cut(s) 333
BseSI GKGCMC 2 cut(s) 108, 529
BseXI GCAGC 9 cut(s) 198, 201, 608, 637, 696, 730, 733, 736, 818
BseYI CCCAGC 1 cut(s) 434
BshFI GGCC 4 cut(s) 75, 126, 150, 836
BshNI GGYRCC 1 cut(s) 103
BsiHKCI CYCGRG 1 cut(s) 738
BsiSI CCGG 2 cut(s) 76, 739
BsnI GGCC 4 cut(s) 75, 126, 150, 836
BsoBI CYCGRG 1 cut(s) 738
Bsp1286I GDGCHC 2 cut(s) 108, 529
Bsp143I GATC 1 cut(s) 733
BspACI CCGC 1 cut(s) 24
BspANI GGCC 4 cut(s) 75, 126, 150, 836
BspCNI CTCAG 2 cut(s) 151, 414
BspLI GGNNCC 1 cut(s) 105
BspPI GGATC 1 cut(s) 728
BspT107I GGYRCC 1 cut(s) 103
BsrDI GCAATG 3 cut(s) 19, 306, 591
BsrI ACTGG 7 cut(s) 171, 274, 361, 388, 411, 644, 827
BssECI CCNNGG 4 cut(s) 487, 737, 738, 864
BssMI GATC 1 cut(s) 733
BssT1I CCWWGG 2 cut(s) 487, 864
Bst2UI CCWGG 1 cut(s) 281
Bst4CI ACNGT 1 cut(s) 103
BstC8I GCNNGC 2 cut(s) 774, 834
BstDEI CTNAG 4 cut(s) 138, 401, 467, 586
BstF5I GGATG 1 cut(s) 713
BstKTI GATC 1 cut(s) 736
BstMBI GATC 1 cut(s) 733
BstMWI GCNNNNNNNGC 8 cut(s) 33, 167, 374, 605, 614, 749, 782, 806
BstNI CCWGG 1 cut(s) 281
BstSCI CCNGG 3 cut(s) 279, 737, 738
BstSFI CTRYAG 1 cut(s) 704
BstSLI GKGCMC 2 cut(s) 108, 529
BstV1I GCAGC 9 cut(s) 198, 201, 608, 637, 696, 730, 733, 736, 818
BstV2I GAAGAC 2 cut(s) 209, 232
BstXI CCANNNNNNTGG 1 cut(s) 226
BsuRI GGCC 4 cut(s) 75, 126, 150, 836
BtsCI GGATG 1 cut(s) 713
BtsI GCAGTG 1 cut(s) 231
BtsIMutI CAGTG 5 cut(s) 164, 231, 479, 651, 834
Cac8I GCNNGC 2 cut(s) 774, 834
CaiI CAGNNNCTG 1 cut(s) 650
Cfr13I GGNCC 1 cut(s) 124
Cfr9I CCCGGG 1 cut(s) 738
Csp6I GTAC 2 cut(s) 462, 822
CviAII CATG 3 cut(s) 89, 250, 816
CviQI GTAC 2 cut(s) 462, 822
DdeI CTNAG 4 cut(s) 138, 401, 467, 586
DpnI GATC 1 cut(s) 735
DpnII GATC 1 cut(s) 733
EaeI YGGCCR 3 cut(s) 73, 148, 834
Eco130I CCWWGG 2 cut(s) 487, 864
Eco57I CTGAAG 3 cut(s) 140, 333, 639
Eco88I CYCGRG 1 cut(s) 738
EcoRII CCWGG 1 cut(s) 279
EcoT14I CCWWGG 2 cut(s) 487, 864
ErhI CCWWGG 2 cut(s) 487, 864
FaeI CATG 3 cut(s) 92, 253, 819
FatI CATG 3 cut(s) 88, 249, 815
FauNDI CATATG 1 cut(s) 619
FokI GGATG 1 cut(s) 700
FspBI CTAG 4 cut(s) 84, 447, 782, 845
GsaI CCCAGC 1 cut(s) 438
GsuI CTGGAG 2 cut(s) 345, 394
HaeIII GGCC 4 cut(s) 75, 126, 150, 836
HapII CCGG 2 cut(s) 76, 739
Hin1II CATG 3 cut(s) 92, 253, 819
HindIII AAGCTT 1 cut(s) 774
HinfI GANTC 2 cut(s) 542, 682
HpaII CCGG 2 cut(s) 76, 739
HphI GGTGA 1 cut(s) 43
Hpy188I TCNGA 2 cut(s) 113, 141
Hpy188III TCNNGA 1 cut(s) 383
HpyAV CCTTC 3 cut(s) 115, 278, 308
HpyCH4III ACNGT 1 cut(s) 103
HpyCH4IV ACGT 2 cut(s) 206, 860
HpyCH4V TGCA 5 cut(s) 161, 581, 596, 772, 819
HpyF10VI GCNNNNNNNGC 8 cut(s) 33, 167, 374, 605, 614, 749, 782, 806
HpyF3I CTNAG 4 cut(s) 138, 401, 467, 586
HpySE526I ACGT 2 cut(s) 206, 860
Hsp92II CATG 3 cut(s) 92, 253, 819
Kzo9I GATC 1 cut(s) 733
LmnI GCTCC 2 cut(s) 320, 500
Lsp1109I GCAGC 9 cut(s) 198, 201, 608, 637, 696, 730, 733, 736, 818
MaeI CTAG 4 cut(s) 84, 447, 782, 845
MaeII ACGT 2 cut(s) 206, 860
MaeIII GTNAC 4 cut(s) 29, 262, 442, 491
MalI GATC 1 cut(s) 735
MboI GATC 1 cut(s) 733
MboII GAAGA 2 cut(s) 214, 232
MfeI CAATTG 1 cut(s) 546
MhlI GDGCHC 2 cut(s) 108, 529
MlsI TGGCCA 2 cut(s) 150, 836
MluCI AATT 7 cut(s) 4, 43, 232, 546, 696, 754, 871
MluNI TGGCCA 2 cut(s) 150, 836
MnlI CCTC 6 cut(s) 147, 311, 332, 410, 610, 820
Mox20I TGGCCA 2 cut(s) 150, 836
MroXI GAANNNNTTC 1 cut(s) 378
MscI TGGCCA 2 cut(s) 150, 836
MseI TTAA 1 cut(s) 39
MslI CAYNNNNRTG 2 cut(s) 224, 248
Msp20I TGGCCA 2 cut(s) 150, 836
MspA1I CMGCKG 1 cut(s) 709
MspI CCGG 2 cut(s) 76, 739
MspR9I CCNGG 3 cut(s) 281, 739, 740
MunI CAATTG 1 cut(s) 546
MvaI CCWGG 1 cut(s) 281
MwoI GCNNNNNNNGC 8 cut(s) 33, 167, 374, 605, 614, 749, 782, 806
NciI CCSGG 2 cut(s) 739, 740
NdeI CATATG 1 cut(s) 619
NdeII GATC 1 cut(s) 733
NlaIII CATG 3 cut(s) 92, 253, 819
NlaIV GGNNCC 1 cut(s) 105
PdmI GAANNNNTTC 1 cut(s) 378
PfeI GAWTC 2 cut(s) 542, 682
PfoI TCCNGGA 1 cut(s) 279
Psp6I CCWGG 1 cut(s) 279
PspFI CCCAGC 1 cut(s) 434
PspGI CCWGG 1 cut(s) 279
PspN4I GGNNCC 1 cut(s) 105
PspPI GGNCC 1 cut(s) 124
PstNI CAGNNNCTG 1 cut(s) 650
PvuII CAGCTG 1 cut(s) 709
RsaI GTAC 2 cut(s) 463, 823
RsaNI GTAC 2 cut(s) 462, 822
RseI CAYNNNNRTG 2 cut(s) 224, 248
SaqAI TTAA 1 cut(s) 39
Sau3AI GATC 1 cut(s) 733
Sau96I GGNCC 1 cut(s) 124
ScrFI CCNGG 3 cut(s) 281, 739, 740
SduI GDGCHC 2 cut(s) 108, 529
SfcI CTRYAG 1 cut(s) 704
SmaI CCCGGG 1 cut(s) 740
SmiMI CAYNNNNRTG 2 cut(s) 224, 248
SmlI CTYRAG 1 cut(s) 689
SmoI CTYRAG 1 cut(s) 689
SpeI ACTAGT 1 cut(s) 83
Sse9I AATT 7 cut(s) 4, 43, 232, 546, 696, 754, 871
SsiI CCGC 1 cut(s) 24
SspMI CTAG 4 cut(s) 84, 447, 782, 845
StyD4I CCNGG 3 cut(s) 279, 737, 738
StyI CCWWGG 2 cut(s) 487, 864
TaaI ACNGT 1 cut(s) 103
TaiI ACGT 2 cut(s) 209, 863
TasI AATT 7 cut(s) 4, 43, 232, 546, 696, 754, 871
TatI WGTACW 1 cut(s) 461
TauI GCSGC 1 cut(s) 27
TfiI GAWTC 2 cut(s) 542, 682
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TscAI CASTG 5 cut(s) 171, 231, 486, 651, 834
TseI GCWGC 9 cut(s) 186, 189, 596, 650, 709, 743, 746, 749, 806
TspDTI ATGAA 3 cut(s) 17, 215, 387
TspMI CCCGGG 1 cut(s) 738
TspRI CASTG 5 cut(s) 171, 231, 486, 651, 834
XapI RAATTY 3 cut(s) 4, 232, 871
XmaI CCCGGG 1 cut(s) 738
XmnI GAANNNNTTC 1 cut(s) 378
XspI CTAG 4 cut(s) 84, 447, 782, 845
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.