Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000031.1

Orthogroup ID

OG0009593

Physical Location & Seq

Genomic Coordinates Forward (+)

145434 .. 150776

Gene Structure 5343 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000031.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1458 bp

atgcttctgcgtctgccttttcgccctggaacacgtttgcatgagcttcgatcctctgcggcgctgagtttcataagccaagaatggaattttcgcatcggcgctctcgatcggaccaatcaaccgtcgtattcgccgtgccgctctttcgcgcctaaaccgccattgctcttctgctctcgttctctctctctctctaacagatttggatttggtttgagaatcgggcatggaggattagagttgggaggagaggctgtgttattaggggccagtcagagcaagaaaggggaggatttcactatggtaaagacggattgtcaaagagttgtgggagatggagtttctacctattcagttttcgcgctatttgacgggcataacgggtctgcagccgctttatactccaaggaagctcttctaaacaatattttagctgctatccccacagatcttaacagagatgaatggattgcagctttgccaaggtcgttggtagcaggctttgtcaagacagacaaagatttccaagagagagctcaaacgtcaggaaccactgtcacctttgtaattatagagggatgggtaatatctgttgcatcggttggcgattctcgttgcatagttgaacctgctgaaggtggagtttattatttatcagcagatcataggcttgaatgcagcgaagacgagaggatgcgtatcacttcaagtggtggtgaggttggtcggctgaatactggcggtggggcagagattggtcccttgaggtgttggcctggtggtttgtgtctttcaagatccattggggatatggacgtaggcgagttcattgttcctgttccttatgtaaagcaaatgaagttgtctactgcaggtggtagggtaatcatatcaagtgatggtgtatgggatgctctgtccgcagaagaagctcttgactgttgtcgtgggatgccaccggatgctgcagctgcccaagtagtcaaggatgctgttggggcaaagggacttcgggatgatacaacctgtattgtgattgacattttaccacaggagaagccaacggctccgttgccgccaccaaagaggcaaggaaaaggagtttttaagtccatgtttaagaaaaagcctaatgaatcatcttctactgttgaaaaagaatatcttgagccagacacagtggaggaaatatttgaggaaggttctgcttctctttccgaaaggttagattcaaagtacccactctgcaacatgtttaagctctttatgtgtgctgtttgtcaagttgaaatcaaaccaggggagggtatttctatacactccgggtcatcctctaacccagaaaaagtgcgaccttgggatggccccttcctttgtactagttgccaagagaagaaagaggctatggaagggaaaagaccatcaggaaatcggcgtgacagcgatagtgattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PP2C

Protein Analysis

485

Amino Acids

52.49

Weight (kDa)

5.56

Isoelectric Point (pI)

43.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009593)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G47380
fragaria_vesca	FvH4_2g34570 FvH4_2g34570 FvH4_2g34570 FvH4_2g34570 FvH4_2g34570
malus_domestica	MD08G1102700.v1.1 MD15G1084200.v1.1
prunus_persica	Prupe.1G437600_v2.0.a1
pyrus_communis	pycom08g08420
rosa_chinensis	RchiOBHm_Chr6g0307591 RchiOBHm_Chr6g0307751
rosa_laevigata	RLG00000010703
rosa_multiflora	Rmu_sc0000031.1_g000027
rosa_roxburghii	Rroxscaffold_7G00160920
rosa_rugosa	Rorug06G0360100 Rorug06G0360200 Rorug06G0360300 Rorug06G0360500
rosa_samantha	Rh6AG469600 Rh6CG485800
rosa_wichuraiana	Rw6G041000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	866
Acc36I	ACCTGC	2 cut(s)	640, 866
AccBSI	CCGCTC	1 cut(s)	144
AccI	GTMKAC	1 cut(s)	869
AccII	CGCG	2 cut(s)	152, 365
AciI	CCGC	7 cut(s)	59, 142, 161, 396, 744, 924, 1079
AclWI	GGATC	2 cut(s)	45, 795
AcsI	RAATTY	1 cut(s)	88
AcuI	CTGAAG	1 cut(s)	657
AfaI	GTAC	2 cut(s)	1241, 1381
AfiI	CCNNNNNNNGG	3 cut(s)	638, 1307, 1364
AflIII	ACRYGT	2 cut(s)	32, 1254
AgsI	TTSAA	7 cut(s)	629, 677, 711, 798, 1157, 1236, 1292
AhdI	GACNNNNNGTC	1 cut(s)	318
AhlI	ACTAGT	1 cut(s)	1382
AjnI	CCWGG	3 cut(s)	25, 778, 1300
AluBI	AGCT	8 cut(s)	46, 416, 437, 479, 539, 935, 974, 1264
AluI	AGCT	8 cut(s)	46, 416, 437, 479, 539, 935, 974, 1264
Alw21I	GWGCWC	1 cut(s)	541
AlwI	GGATC	2 cut(s)	45, 795
AoxI	GGCC	3 cut(s)	270, 776, 1366
ApeKI	GCWGC	7 cut(s)	392, 437, 476, 681, 968, 971, 974
ApoI	RAATTY	1 cut(s)	88
Asp700I	GAANNNNTTC	1 cut(s)	417
AspLEI	GCGC	4 cut(s)	64, 104, 154, 367
AspS9I	GGNCC	4 cut(s)	114, 270, 761, 1367
AsuC2I	CCSGG	1 cut(s)	1327
AsuHPI	GGTGA	2 cut(s)	553, 731
AvaII	GGWCC	2 cut(s)	114, 761
BanII	GRGCYC	1 cut(s)	541
BbsI	GAAGAC	1 cut(s)	693
Bbv12I	GWGCWC	1 cut(s)	541
BbvI	GCAGC	7 cut(s)	404, 424, 488, 693, 955, 961, 983
BccI	CCATC	5 cut(s)	332, 576, 896, 1358, 1432
BceAI	ACGGC	2 cut(s)	121, 1083
BcgI	CGANNNNNNTGC	2 cut(s)	29, 63
BciT130I	CCWGG	3 cut(s)	27, 780, 1302
BcnI	CCSGG	1 cut(s)	1327
BcuI	ACTAGT	1 cut(s)	1382
BfaI	CTAG	1 cut(s)	1383
BfmI	CTRYAG	3 cut(s)	390, 873, 969
BfoI	RGCGCY	2 cut(s)	65, 105
BfuAI	ACCTGC	2 cut(s)	640, 866
BglII	AGATCT	1 cut(s)	451
Bme1390I	CCNGG	4 cut(s)	27, 780, 1302, 1327
Bme18I	GGWCC	2 cut(s)	114, 761
BmeRI	GACNNNNNGTC	1 cut(s)	318
BmgT120I	GGNCC	4 cut(s)	114, 270, 761, 1367
BmiI	GGNNCC	5 cut(s)	271, 553, 763, 1071, 1369
BmrFI	CCNGG	4 cut(s)	27, 780, 1302, 1327
BmsI	GCATC	7 cut(s)	105, 608, 687, 904, 945, 955, 982
BoxI	GACNNNNGTC	1 cut(s)	945
BpiI	GAAGAC	1 cut(s)	693
BpuEI	CTTGAG	2 cut(s)	787, 1190
BpuMI	CCSGG	1 cut(s)	1327
BsaBI	GATNNNNATC	1 cut(s)	701
BsaJI	CCNNGG	5 cut(s)	25, 408, 485, 1301, 1358
BsaWI	WCCGGW	1 cut(s)	961
BsaXI	ACNNNNNCTCC	4 cut(s)	243, 273, 327, 357
Bsc4I	CCNNNNNNNGG	3 cut(s)	638, 1307, 1364
Bse1I	ACTGG	2 cut(s)	273, 745
Bse3DI	GCAATG	1 cut(s)	164
Bse8I	GATNNNNATC	1 cut(s)	701
BseBI	CCWGG	3 cut(s)	27, 780, 1302
BseDI	CCNNGG	5 cut(s)	25, 408, 485, 1301, 1358
BseGI	GGATG	9 cut(s)	587, 702, 919, 960, 970, 997, 1024, 1331, 1369
BseJI	GATNNNNATC	1 cut(s)	701
BseLI	CCNNNNNNNGG	3 cut(s)	638, 1307, 1364
BseMI	GCAATG	1 cut(s)	164
BseMII	CTCAG	1 cut(s)	56
BseNI	ACTGG	2 cut(s)	273, 745
BseRI	GAGGAG	1 cut(s)	264
BseXI	GCAGC	7 cut(s)	404, 424, 488, 693, 955, 961, 983
Bsh1236I	CGCG	2 cut(s)	152, 365
Bsh1285I	CGRYCG	1 cut(s)	112
BshFI	GGCC	3 cut(s)	272, 778, 1368
BsiEI	CGRYCG	1 cut(s)	112
BsiHKAI	GWGCWC	1 cut(s)	541
BsiSI	CCGG	2 cut(s)	962, 1326
BslFI	GGGAC	2 cut(s)	747, 1023
BslI	CCNNNNNNNGG	3 cut(s)	638, 1307, 1364
BsmFI	GGGAC	2 cut(s)	747, 1023
BsmI	GAATGC	1 cut(s)	683
BsnI	GGCC	3 cut(s)	272, 778, 1368
Bsp1286I	GDGCHC	1 cut(s)	541
Bsp143I	GATC	5 cut(s)	50, 109, 451, 664, 800
BspACI	CCGC	7 cut(s)	59, 142, 161, 396, 744, 924, 1079
BspANI	GGCC	3 cut(s)	272, 778, 1368
BspCNI	CTCAG	1 cut(s)	57
BspFNI	CGCG	2 cut(s)	152, 365
BspLI	GGNNCC	5 cut(s)	271, 553, 763, 1071, 1369
BspMAI	CTGCAG	3 cut(s)	394, 877, 973
BspMI	ACCTGC	2 cut(s)	640, 866
BspPI	GGATC	2 cut(s)	45, 795
BspQI	GCTCTTC	2 cut(s)	176, 423
BsrBI	CCGCTC	1 cut(s)	144
BsrDI	GCAATG	1 cut(s)	164
BsrI	ACTGG	2 cut(s)	273, 745
BssECI	CCNNGG	5 cut(s)	25, 408, 485, 1301, 1358
BssMI	GATC	5 cut(s)	50, 109, 451, 664, 800
BssT1I	CCWWGG	3 cut(s)	408, 485, 1358
Bst2UI	CCWGG	3 cut(s)	27, 780, 1302
Bst4CI	ACNGT	5 cut(s)	126, 559, 944, 1153, 1183
Bst6I	CTCTTC	2 cut(s)	176, 423
BstC8I	GCNNGC	1 cut(s)	502
BstDEI	CTNAG	1 cut(s)	65
BstENI	CCTNNNNNAGG	1 cut(s)	636
BstF5I	GGATG	9 cut(s)	587, 702, 919, 960, 970, 997, 1024, 1331, 1369
BstFNI	CGCG	2 cut(s)	152, 365
BstH2I	RGCGCY	2 cut(s)	65, 105
BstHHI	GCGC	4 cut(s)	64, 104, 154, 367
BstKTI	GATC	5 cut(s)	53, 112, 454, 667, 803
BstMBI	GATC	5 cut(s)	50, 109, 451, 664, 800
BstMCI	CGRYCG	1 cut(s)	112
BstMWI	GCNNNNNNNGC	5 cut(s)	160, 923, 932, 974, 1001
BstNI	CCWGG	3 cut(s)	27, 780, 1302
BstNSI	RCATGY	1 cut(s)	1258
BstPAI	GACNNNNGTC	1 cut(s)	945
BstSCI	CCNGG	4 cut(s)	25, 778, 1300, 1325
BstSFI	CTRYAG	3 cut(s)	390, 873, 969
BstUI	CGCG	2 cut(s)	152, 365
BstV1I	GCAGC	7 cut(s)	404, 424, 488, 693, 955, 961, 983
BstV2I	GAAGAC	1 cut(s)	693
BstX2I	RGATCY	2 cut(s)	451, 800
BstYI	RGATCY	2 cut(s)	451, 800
BsuRI	GGCC	3 cut(s)	272, 778, 1368
BtsCI	GGATG	9 cut(s)	587, 702, 919, 960, 970, 997, 1024, 1331, 1369
BtsIMutI	CAGTG	2 cut(s)	555, 1188
BveI	ACCTGC	2 cut(s)	640, 866
Cac8I	GCNNGC	1 cut(s)	502
CfoI	GCGC	4 cut(s)	64, 104, 154, 367
Cfr13I	GGNCC	4 cut(s)	114, 270, 761, 1367
Csp6I	GTAC	2 cut(s)	1240, 1380
CviAII	CATG	4 cut(s)	41, 230, 1117, 1255
CviQI	GTAC	2 cut(s)	1240, 1380
DdeI	CTNAG	1 cut(s)	65
DpnI	GATC	5 cut(s)	52, 111, 453, 666, 802
DpnII	GATC	5 cut(s)	50, 109, 451, 664, 800
DriI	GACNNNNNGTC	1 cut(s)	318
Eam1104I	CTCTTC	2 cut(s)	176, 423
Eam1105I	GACNNNNNGTC	1 cut(s)	318
EarI	CTCTTC	2 cut(s)	176, 423
Ecl136II	GAGCTC	1 cut(s)	539
Eco130I	CCWWGG	3 cut(s)	408, 485, 1358
Eco24I	GRGCYC	1 cut(s)	541
Eco47I	GGWCC	2 cut(s)	114, 761
Eco53kI	GAGCTC	1 cut(s)	539
Eco57I	CTGAAG	1 cut(s)	657
EcoICRI	GAGCTC	1 cut(s)	539
EcoNI	CCTNNNNNAGG	1 cut(s)	636
EcoRII	CCWGG	3 cut(s)	25, 778, 1300
EcoT14I	CCWWGG	3 cut(s)	408, 485, 1358
EcoT38I	GRGCYC	1 cut(s)	541
ErhI	CCWWGG	3 cut(s)	408, 485, 1358
FaeI	CATG	4 cut(s)	44, 233, 1120, 1258
FalI	AAGNNNNNCTT	4 cut(s)	921, 953, 1152, 1184
FaqI	GGGAC	2 cut(s)	747, 1023
FatI	CATG	4 cut(s)	40, 229, 1116, 1254
FblI	GTMKAC	1 cut(s)	869
FokI	GGATG	9 cut(s)	594, 709, 926, 967, 977, 1004, 1031, 1318, 1376
FriOI	GRGCYC	1 cut(s)	541
FspBI	CTAG	1 cut(s)	1383
GlaI	GCGC	4 cut(s)	63, 103, 153, 366
HaeII	RGCGCY	2 cut(s)	65, 105
HaeIII	GGCC	3 cut(s)	272, 778, 1368
HapII	CCGG	2 cut(s)	962, 1326
HhaI	GCGC	4 cut(s)	64, 104, 154, 367
Hin1II	CATG	4 cut(s)	44, 233, 1120, 1258
Hin6I	GCGC	4 cut(s)	62, 102, 152, 365
HinP1I	GCGC	4 cut(s)	62, 102, 152, 365
HinfI	GANTC	4 cut(s)	222, 611, 1139, 1232
HpaII	CCGG	2 cut(s)	962, 1326
HphI	GGTGA	2 cut(s)	553, 731
Hpy166II	GTNNAC	1 cut(s)	870
Hpy188I	TCNGA	3 cut(s)	114, 279, 1222
Hpy188III	TCNNGA	8 cut(s)	107, 511, 549, 798, 938, 1016, 1169, 1428
Hpy8I	GTNNAC	1 cut(s)	870
Hpy99I	CGWCG	1 cut(s)	130
HpyAV	CCTTC	4 cut(s)	632, 1196, 1381, 1406
HpyCH4III	ACNGT	5 cut(s)	126, 559, 944, 1153, 1183
HpyCH4IV	ACGT	3 cut(s)	34, 545, 819
HpyCH4V	TGCA	9 cut(s)	40, 392, 476, 599, 621, 681, 875, 971, 1251
HpyF10VI	GCNNNNNNNGC	5 cut(s)	160, 923, 932, 974, 1001
HpyF3I	CTNAG	1 cut(s)	65
HpySE526I	ACGT	3 cut(s)	34, 545, 819
Hsp92II	CATG	4 cut(s)	44, 233, 1120, 1258
HspAI	GCGC	4 cut(s)	62, 102, 152, 365
Kzo9I	GATC	5 cut(s)	50, 109, 451, 664, 800
LguI	GCTCTTC	2 cut(s)	176, 423
LmnI	GCTCC	1 cut(s)	1075
Lsp1109I	GCAGC	7 cut(s)	404, 424, 488, 693, 955, 961, 983
LweI	GCATC	7 cut(s)	105, 608, 687, 904, 945, 955, 982
MaeI	CTAG	1 cut(s)	1383
MaeII	ACGT	3 cut(s)	34, 545, 819
MaeIII	GTNAC	2 cut(s)	559, 1439
MalI	GATC	5 cut(s)	52, 111, 453, 666, 802
MbiI	CCGCTC	1 cut(s)	144
MboI	GATC	5 cut(s)	50, 109, 451, 664, 800
MboII	GAAGA	6 cut(s)	163, 410, 698, 941, 1137, 1408
MflI	RGATCY	2 cut(s)	451, 800
MhlI	GDGCHC	1 cut(s)	541
MluCI	AATT	2 cut(s)	88, 570
MroXI	GAANNNNTTC	1 cut(s)	417
MseI	TTAA	4 cut(s)	456, 1110, 1122, 1260
MspA1I	CMGCKG	1 cut(s)	974
MspI	CCGG	2 cut(s)	962, 1326
MspR9I	CCNGG	4 cut(s)	27, 780, 1302, 1327
Mva1269I	GAATGC	1 cut(s)	683
MvaI	CCWGG	3 cut(s)	27, 780, 1302
MvnI	CGCG	2 cut(s)	152, 365
MwoI	GCNNNNNNNGC	5 cut(s)	160, 923, 932, 974, 1001
NciI	CCSGG	1 cut(s)	1327
NdeII	GATC	5 cut(s)	50, 109, 451, 664, 800
NlaIII	CATG	4 cut(s)	44, 233, 1120, 1258
NlaIV	GGNNCC	5 cut(s)	271, 553, 763, 1071, 1369
NmuCI	GTSAC	2 cut(s)	559, 1439
NspI	RCATGY	1 cut(s)	1258
PaqCI	CACCTGC	1 cut(s)	866
PciI	ACATGT	1 cut(s)	1254
PciSI	GCTCTTC	2 cut(s)	176, 423
PcsI	WCGNNNNNNNCGW	2 cut(s)	105, 134
PctI	GAATGC	1 cut(s)	683
PdmI	GAANNNNTTC	1 cut(s)	417
PfeI	GAWTC	4 cut(s)	222, 611, 1139, 1232
Ple19I	CGATCG	1 cut(s)	112
PscI	ACATGT	1 cut(s)	1254
PshAI	GACNNNNGTC	1 cut(s)	945
Psp124BI	GAGCTC	1 cut(s)	541
Psp6I	CCWGG	3 cut(s)	25, 778, 1300
PspGI	CCWGG	3 cut(s)	25, 778, 1300
PspN4I	GGNNCC	5 cut(s)	271, 553, 763, 1071, 1369
PspPI	GGNCC	4 cut(s)	114, 270, 761, 1367
PstI	CTGCAG	3 cut(s)	394, 877, 973
PsuI	RGATCY	2 cut(s)	451, 800
PvuI	CGATCG	1 cut(s)	112
PvuII	CAGCTG	1 cut(s)	974
RsaI	GTAC	2 cut(s)	1241, 1381
RsaNI	GTAC	2 cut(s)	1240, 1380
SacI	GAGCTC	1 cut(s)	541
SapI	GCTCTTC	2 cut(s)	176, 423
SaqAI	TTAA	4 cut(s)	456, 1110, 1122, 1260
Sau3AI	GATC	5 cut(s)	50, 109, 451, 664, 800
Sau96I	GGNCC	4 cut(s)	114, 270, 761, 1367
ScrFI	CCNGG	4 cut(s)	27, 780, 1302, 1327
SduI	GDGCHC	1 cut(s)	541
SfaNI	GCATC	7 cut(s)	105, 608, 687, 904, 945, 955, 982
SfcI	CTRYAG	3 cut(s)	390, 873, 969
SinI	GGWCC	2 cut(s)	114, 761
SmlI	CTYRAG	2 cut(s)	766, 1169
SmoI	CTYRAG	2 cut(s)	766, 1169
SpeI	ACTAGT	1 cut(s)	1382
Sse9I	AATT	2 cut(s)	88, 570
SsiI	CCGC	7 cut(s)	59, 142, 161, 396, 744, 924, 1079
SspI	AATATT	2 cut(s)	430, 1194
SspMI	CTAG	1 cut(s)	1383
SstI	GAGCTC	1 cut(s)	541
StyD4I	CCNGG	4 cut(s)	25, 778, 1300, 1325
StyI	CCWWGG	3 cut(s)	408, 485, 1358
TaaI	ACNGT	5 cut(s)	126, 559, 944, 1153, 1183
TaiI	ACGT	3 cut(s)	37, 548, 822
TaqI	TCGA	2 cut(s)	49, 108
TasI	AATT	2 cut(s)	88, 570
TatI	WGTACW	1 cut(s)	1379
TauI	GCSGC	4 cut(s)	62, 144, 398, 1081
TfiI	GAWTC	4 cut(s)	222, 611, 1139, 1232
Tru1I	TTAA	4 cut(s)	456, 1110, 1122, 1260
Tru9I	TTAA	4 cut(s)	456, 1110, 1122, 1260
TscAI	CASTG	2 cut(s)	562, 1188
TseFI	GTSAC	2 cut(s)	559, 1439
TseI	GCWGC	7 cut(s)	392, 437, 476, 681, 968, 971, 974
Tsp45I	GTSAC	2 cut(s)	559, 1439
TspDTI	ATGAA	5 cut(s)	61, 480, 820, 875, 1152
TspGWI	ACGGA	2 cut(s)	329, 1062
TspRI	CASTG	2 cut(s)	562, 1188
VpaK11BI	GGWCC	2 cut(s)	114, 761
XagI	CCTNNNNNAGG	1 cut(s)	636
XapI	RAATTY	1 cut(s)	88
XceI	RCATGY	1 cut(s)	1258
XcmI	CCANNNNNNNNNTGG	1 cut(s)	811
XmiI	GTMKAC	1 cut(s)	869
XmnI	GAANNNNTTC	1 cut(s)	417
XspI	CTAG	1 cut(s)	1383

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.