Rmu_sc0000031.1_g000027

phosphatase 2c

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000031.1
OG0009593
Physical Location & Seq
Forward (+)
145434 .. 150776
5343 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1458 bp
atgcttctgcgtctgccttttcgccctggaacacgtttgcatgagcttcgatcctctgcggcgctgagtttcataagccaagaatggaattttcgcatcggcgctctcgatcggaccaatcaaccgtcgtattcgccgtgccgctctttcgcgcctaaaccgccattgctcttctgctctcgttctctctctctctctaacagatttggatttggtttgagaatcgggcatggaggattagagttgggaggagaggctgtgttattaggggccagtcagagcaagaaaggggaggatttcactatggtaaagacggattgtcaaagagttgtgggagatggagtttctacctattcagttttcgcgctatttgacgggcataacgggtctgcagccgctttatactccaaggaagctcttctaaacaatattttagctgctatccccacagatcttaacagagatgaatggattgcagctttgccaaggtcgttggtagcaggctttgtcaagacagacaaagatttccaagagagagctcaaacgtcaggaaccactgtcacctttgtaattatagagggatgggtaatatctgttgcatcggttggcgattctcgttgcatagttgaacctgctgaaggtggagtttattatttatcagcagatcataggcttgaatgcagcgaagacgagaggatgcgtatcacttcaagtggtggtgaggttggtcggctgaatactggcggtggggcagagattggtcccttgaggtgttggcctggtggtttgtgtctttcaagatccattggggatatggacgtaggcgagttcattgttcctgttccttatgtaaagcaaatgaagttgtctactgcaggtggtagggtaatcatatcaagtgatggtgtatgggatgctctgtccgcagaagaagctcttgactgttgtcgtgggatgccaccggatgctgcagctgcccaagtagtcaaggatgctgttggggcaaagggacttcgggatgatacaacctgtattgtgattgacattttaccacaggagaagccaacggctccgttgccgccaccaaagaggcaaggaaaaggagtttttaagtccatgtttaagaaaaagcctaatgaatcatcttctactgttgaaaaagaatatcttgagccagacacagtggaggaaatatttgaggaaggttctgcttctctttccgaaaggttagattcaaagtacccactctgcaacatgtttaagctctttatgtgtgctgtttgtcaagttgaaatcaaaccaggggagggtatttctatacactccgggtcatcctctaacccagaaaaagtgcgaccttgggatggccccttcctttgtactagttgccaagagaagaaagaggctatggaagggaaaagaccatcaggaaatcggcgtgacagcgatagtgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2C

Protein Analysis

485

Amino Acids

52.49

Weight (kDa)

5.56

Isoelectric Point (pI)

43.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2C PF00481 113 - 332 2.1e-28 Protein phosphatase 2C
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 866
Acc36I ACCTGC 2 cut(s) 640, 866
AccBSI CCGCTC 1 cut(s) 144
AccI GTMKAC 1 cut(s) 869
AccII CGCG 2 cut(s) 152, 365
AciI CCGC 7 cut(s) 59, 142, 161, 396, 744, 924, 1079
AclWI GGATC 2 cut(s) 45, 795
AcsI RAATTY 1 cut(s) 88
AcuI CTGAAG 1 cut(s) 657
AfaI GTAC 2 cut(s) 1241, 1381
AfiI CCNNNNNNNGG 3 cut(s) 638, 1307, 1364
AflIII ACRYGT 2 cut(s) 32, 1254
AgsI TTSAA 7 cut(s) 629, 677, 711, 798, 1157, 1236, 1292
AhdI GACNNNNNGTC 1 cut(s) 318
AhlI ACTAGT 1 cut(s) 1382
AjnI CCWGG 3 cut(s) 25, 778, 1300
AluBI AGCT 8 cut(s) 46, 416, 437, 479, 539, 935, 974, 1264
AluI AGCT 8 cut(s) 46, 416, 437, 479, 539, 935, 974, 1264
Alw21I GWGCWC 1 cut(s) 541
AlwI GGATC 2 cut(s) 45, 795
AoxI GGCC 3 cut(s) 270, 776, 1366
ApeKI GCWGC 7 cut(s) 392, 437, 476, 681, 968, 971, 974
ApoI RAATTY 1 cut(s) 88
Asp700I GAANNNNTTC 1 cut(s) 417
AspLEI GCGC 4 cut(s) 64, 104, 154, 367
AspS9I GGNCC 4 cut(s) 114, 270, 761, 1367
AsuC2I CCSGG 1 cut(s) 1327
AsuHPI GGTGA 2 cut(s) 553, 731
AvaII GGWCC 2 cut(s) 114, 761
BanII GRGCYC 1 cut(s) 541
BbsI GAAGAC 1 cut(s) 693
Bbv12I GWGCWC 1 cut(s) 541
BbvI GCAGC 7 cut(s) 404, 424, 488, 693, 955, 961, 983
BccI CCATC 5 cut(s) 332, 576, 896, 1358, 1432
BceAI ACGGC 2 cut(s) 121, 1083
BcgI CGANNNNNNTGC 2 cut(s) 29, 63
BciT130I CCWGG 3 cut(s) 27, 780, 1302
BcnI CCSGG 1 cut(s) 1327
BcuI ACTAGT 1 cut(s) 1382
BfaI CTAG 1 cut(s) 1383
BfmI CTRYAG 3 cut(s) 390, 873, 969
BfoI RGCGCY 2 cut(s) 65, 105
BfuAI ACCTGC 2 cut(s) 640, 866
BglII AGATCT 1 cut(s) 451
Bme1390I CCNGG 4 cut(s) 27, 780, 1302, 1327
Bme18I GGWCC 2 cut(s) 114, 761
BmeRI GACNNNNNGTC 1 cut(s) 318
BmgT120I GGNCC 4 cut(s) 114, 270, 761, 1367
BmiI GGNNCC 5 cut(s) 271, 553, 763, 1071, 1369
BmrFI CCNGG 4 cut(s) 27, 780, 1302, 1327
BmsI GCATC 7 cut(s) 105, 608, 687, 904, 945, 955, 982
BoxI GACNNNNGTC 1 cut(s) 945
BpiI GAAGAC 1 cut(s) 693
BpuEI CTTGAG 2 cut(s) 787, 1190
BpuMI CCSGG 1 cut(s) 1327
BsaBI GATNNNNATC 1 cut(s) 701
BsaJI CCNNGG 5 cut(s) 25, 408, 485, 1301, 1358
BsaWI WCCGGW 1 cut(s) 961
BsaXI ACNNNNNCTCC 4 cut(s) 243, 273, 327, 357
Bsc4I CCNNNNNNNGG 3 cut(s) 638, 1307, 1364
Bse1I ACTGG 2 cut(s) 273, 745
Bse3DI GCAATG 1 cut(s) 164
Bse8I GATNNNNATC 1 cut(s) 701
BseBI CCWGG 3 cut(s) 27, 780, 1302
BseDI CCNNGG 5 cut(s) 25, 408, 485, 1301, 1358
BseGI GGATG 9 cut(s) 587, 702, 919, 960, 970, 997, 1024, 1331, 1369
BseJI GATNNNNATC 1 cut(s) 701
BseLI CCNNNNNNNGG 3 cut(s) 638, 1307, 1364
BseMI GCAATG 1 cut(s) 164
BseMII CTCAG 1 cut(s) 56
BseNI ACTGG 2 cut(s) 273, 745
BseRI GAGGAG 1 cut(s) 264
BseXI GCAGC 7 cut(s) 404, 424, 488, 693, 955, 961, 983
Bsh1236I CGCG 2 cut(s) 152, 365
Bsh1285I CGRYCG 1 cut(s) 112
BshFI GGCC 3 cut(s) 272, 778, 1368
BsiEI CGRYCG 1 cut(s) 112
BsiHKAI GWGCWC 1 cut(s) 541
BsiSI CCGG 2 cut(s) 962, 1326
BslFI GGGAC 2 cut(s) 747, 1023
BslI CCNNNNNNNGG 3 cut(s) 638, 1307, 1364
BsmFI GGGAC 2 cut(s) 747, 1023
BsmI GAATGC 1 cut(s) 683
BsnI GGCC 3 cut(s) 272, 778, 1368
Bsp1286I GDGCHC 1 cut(s) 541
Bsp143I GATC 5 cut(s) 50, 109, 451, 664, 800
BspACI CCGC 7 cut(s) 59, 142, 161, 396, 744, 924, 1079
BspANI GGCC 3 cut(s) 272, 778, 1368
BspCNI CTCAG 1 cut(s) 57
BspFNI CGCG 2 cut(s) 152, 365
BspLI GGNNCC 5 cut(s) 271, 553, 763, 1071, 1369
BspMAI CTGCAG 3 cut(s) 394, 877, 973
BspMI ACCTGC 2 cut(s) 640, 866
BspPI GGATC 2 cut(s) 45, 795
BspQI GCTCTTC 2 cut(s) 176, 423
BsrBI CCGCTC 1 cut(s) 144
BsrDI GCAATG 1 cut(s) 164
BsrI ACTGG 2 cut(s) 273, 745
BssECI CCNNGG 5 cut(s) 25, 408, 485, 1301, 1358
BssMI GATC 5 cut(s) 50, 109, 451, 664, 800
BssT1I CCWWGG 3 cut(s) 408, 485, 1358
Bst2UI CCWGG 3 cut(s) 27, 780, 1302
Bst4CI ACNGT 5 cut(s) 126, 559, 944, 1153, 1183
Bst6I CTCTTC 2 cut(s) 176, 423
BstC8I GCNNGC 1 cut(s) 502
BstDEI CTNAG 1 cut(s) 65
BstENI CCTNNNNNAGG 1 cut(s) 636
BstF5I GGATG 9 cut(s) 587, 702, 919, 960, 970, 997, 1024, 1331, 1369
BstFNI CGCG 2 cut(s) 152, 365
BstH2I RGCGCY 2 cut(s) 65, 105
BstHHI GCGC 4 cut(s) 64, 104, 154, 367
BstKTI GATC 5 cut(s) 53, 112, 454, 667, 803
BstMBI GATC 5 cut(s) 50, 109, 451, 664, 800
BstMCI CGRYCG 1 cut(s) 112
BstMWI GCNNNNNNNGC 5 cut(s) 160, 923, 932, 974, 1001
BstNI CCWGG 3 cut(s) 27, 780, 1302
BstNSI RCATGY 1 cut(s) 1258
BstPAI GACNNNNGTC 1 cut(s) 945
BstSCI CCNGG 4 cut(s) 25, 778, 1300, 1325
BstSFI CTRYAG 3 cut(s) 390, 873, 969
BstUI CGCG 2 cut(s) 152, 365
BstV1I GCAGC 7 cut(s) 404, 424, 488, 693, 955, 961, 983
BstV2I GAAGAC 1 cut(s) 693
BstX2I RGATCY 2 cut(s) 451, 800
BstYI RGATCY 2 cut(s) 451, 800
BsuRI GGCC 3 cut(s) 272, 778, 1368
BtsCI GGATG 9 cut(s) 587, 702, 919, 960, 970, 997, 1024, 1331, 1369
BtsIMutI CAGTG 2 cut(s) 555, 1188
BveI ACCTGC 2 cut(s) 640, 866
Cac8I GCNNGC 1 cut(s) 502
CfoI GCGC 4 cut(s) 64, 104, 154, 367
Cfr13I GGNCC 4 cut(s) 114, 270, 761, 1367
Csp6I GTAC 2 cut(s) 1240, 1380
CviAII CATG 4 cut(s) 41, 230, 1117, 1255
CviQI GTAC 2 cut(s) 1240, 1380
DdeI CTNAG 1 cut(s) 65
DpnI GATC 5 cut(s) 52, 111, 453, 666, 802
DpnII GATC 5 cut(s) 50, 109, 451, 664, 800
DriI GACNNNNNGTC 1 cut(s) 318
Eam1104I CTCTTC 2 cut(s) 176, 423
Eam1105I GACNNNNNGTC 1 cut(s) 318
EarI CTCTTC 2 cut(s) 176, 423
Ecl136II GAGCTC 1 cut(s) 539
Eco130I CCWWGG 3 cut(s) 408, 485, 1358
Eco24I GRGCYC 1 cut(s) 541
Eco47I GGWCC 2 cut(s) 114, 761
Eco53kI GAGCTC 1 cut(s) 539
Eco57I CTGAAG 1 cut(s) 657
EcoICRI GAGCTC 1 cut(s) 539
EcoNI CCTNNNNNAGG 1 cut(s) 636
EcoRII CCWGG 3 cut(s) 25, 778, 1300
EcoT14I CCWWGG 3 cut(s) 408, 485, 1358
EcoT38I GRGCYC 1 cut(s) 541
ErhI CCWWGG 3 cut(s) 408, 485, 1358
FaeI CATG 4 cut(s) 44, 233, 1120, 1258
FalI AAGNNNNNCTT 4 cut(s) 921, 953, 1152, 1184
FaqI GGGAC 2 cut(s) 747, 1023
FatI CATG 4 cut(s) 40, 229, 1116, 1254
FblI GTMKAC 1 cut(s) 869
FokI GGATG 9 cut(s) 594, 709, 926, 967, 977, 1004, 1031, 1318, 1376
FriOI GRGCYC 1 cut(s) 541
FspBI CTAG 1 cut(s) 1383
GlaI GCGC 4 cut(s) 63, 103, 153, 366
HaeII RGCGCY 2 cut(s) 65, 105
HaeIII GGCC 3 cut(s) 272, 778, 1368
HapII CCGG 2 cut(s) 962, 1326
HhaI GCGC 4 cut(s) 64, 104, 154, 367
Hin1II CATG 4 cut(s) 44, 233, 1120, 1258
Hin6I GCGC 4 cut(s) 62, 102, 152, 365
HinP1I GCGC 4 cut(s) 62, 102, 152, 365
HinfI GANTC 4 cut(s) 222, 611, 1139, 1232
HpaII CCGG 2 cut(s) 962, 1326
HphI GGTGA 2 cut(s) 553, 731
Hpy166II GTNNAC 1 cut(s) 870
Hpy188I TCNGA 3 cut(s) 114, 279, 1222
Hpy188III TCNNGA 8 cut(s) 107, 511, 549, 798, 938, 1016, 1169, 1428
Hpy8I GTNNAC 1 cut(s) 870
Hpy99I CGWCG 1 cut(s) 130
HpyAV CCTTC 4 cut(s) 632, 1196, 1381, 1406
HpyCH4III ACNGT 5 cut(s) 126, 559, 944, 1153, 1183
HpyCH4IV ACGT 3 cut(s) 34, 545, 819
HpyCH4V TGCA 9 cut(s) 40, 392, 476, 599, 621, 681, 875, 971, 1251
HpyF10VI GCNNNNNNNGC 5 cut(s) 160, 923, 932, 974, 1001
HpyF3I CTNAG 1 cut(s) 65
HpySE526I ACGT 3 cut(s) 34, 545, 819
Hsp92II CATG 4 cut(s) 44, 233, 1120, 1258
HspAI GCGC 4 cut(s) 62, 102, 152, 365
Kzo9I GATC 5 cut(s) 50, 109, 451, 664, 800
LguI GCTCTTC 2 cut(s) 176, 423
LmnI GCTCC 1 cut(s) 1075
Lsp1109I GCAGC 7 cut(s) 404, 424, 488, 693, 955, 961, 983
LweI GCATC 7 cut(s) 105, 608, 687, 904, 945, 955, 982
MaeI CTAG 1 cut(s) 1383
MaeII ACGT 3 cut(s) 34, 545, 819
MaeIII GTNAC 2 cut(s) 559, 1439
MalI GATC 5 cut(s) 52, 111, 453, 666, 802
MbiI CCGCTC 1 cut(s) 144
MboI GATC 5 cut(s) 50, 109, 451, 664, 800
MboII GAAGA 6 cut(s) 163, 410, 698, 941, 1137, 1408
MflI RGATCY 2 cut(s) 451, 800
MhlI GDGCHC 1 cut(s) 541
MluCI AATT 2 cut(s) 88, 570
MroXI GAANNNNTTC 1 cut(s) 417
MseI TTAA 4 cut(s) 456, 1110, 1122, 1260
MspA1I CMGCKG 1 cut(s) 974
MspI CCGG 2 cut(s) 962, 1326
MspR9I CCNGG 4 cut(s) 27, 780, 1302, 1327
Mva1269I GAATGC 1 cut(s) 683
MvaI CCWGG 3 cut(s) 27, 780, 1302
MvnI CGCG 2 cut(s) 152, 365
MwoI GCNNNNNNNGC 5 cut(s) 160, 923, 932, 974, 1001
NciI CCSGG 1 cut(s) 1327
NdeII GATC 5 cut(s) 50, 109, 451, 664, 800
NlaIII CATG 4 cut(s) 44, 233, 1120, 1258
NlaIV GGNNCC 5 cut(s) 271, 553, 763, 1071, 1369
NmuCI GTSAC 2 cut(s) 559, 1439
NspI RCATGY 1 cut(s) 1258
PaqCI CACCTGC 1 cut(s) 866
PciI ACATGT 1 cut(s) 1254
PciSI GCTCTTC 2 cut(s) 176, 423
PcsI WCGNNNNNNNCGW 2 cut(s) 105, 134
PctI GAATGC 1 cut(s) 683
PdmI GAANNNNTTC 1 cut(s) 417
PfeI GAWTC 4 cut(s) 222, 611, 1139, 1232
Ple19I CGATCG 1 cut(s) 112
PscI ACATGT 1 cut(s) 1254
PshAI GACNNNNGTC 1 cut(s) 945
Psp124BI GAGCTC 1 cut(s) 541
Psp6I CCWGG 3 cut(s) 25, 778, 1300
PspGI CCWGG 3 cut(s) 25, 778, 1300
PspN4I GGNNCC 5 cut(s) 271, 553, 763, 1071, 1369
PspPI GGNCC 4 cut(s) 114, 270, 761, 1367
PstI CTGCAG 3 cut(s) 394, 877, 973
PsuI RGATCY 2 cut(s) 451, 800
PvuI CGATCG 1 cut(s) 112
PvuII CAGCTG 1 cut(s) 974
RsaI GTAC 2 cut(s) 1241, 1381
RsaNI GTAC 2 cut(s) 1240, 1380
SacI GAGCTC 1 cut(s) 541
SapI GCTCTTC 2 cut(s) 176, 423
SaqAI TTAA 4 cut(s) 456, 1110, 1122, 1260
Sau3AI GATC 5 cut(s) 50, 109, 451, 664, 800
Sau96I GGNCC 4 cut(s) 114, 270, 761, 1367
ScrFI CCNGG 4 cut(s) 27, 780, 1302, 1327
SduI GDGCHC 1 cut(s) 541
SfaNI GCATC 7 cut(s) 105, 608, 687, 904, 945, 955, 982
SfcI CTRYAG 3 cut(s) 390, 873, 969
SinI GGWCC 2 cut(s) 114, 761
SmlI CTYRAG 2 cut(s) 766, 1169
SmoI CTYRAG 2 cut(s) 766, 1169
SpeI ACTAGT 1 cut(s) 1382
Sse9I AATT 2 cut(s) 88, 570
SsiI CCGC 7 cut(s) 59, 142, 161, 396, 744, 924, 1079
SspI AATATT 2 cut(s) 430, 1194
SspMI CTAG 1 cut(s) 1383
SstI GAGCTC 1 cut(s) 541
StyD4I CCNGG 4 cut(s) 25, 778, 1300, 1325
StyI CCWWGG 3 cut(s) 408, 485, 1358
TaaI ACNGT 5 cut(s) 126, 559, 944, 1153, 1183
TaiI ACGT 3 cut(s) 37, 548, 822
TaqI TCGA 2 cut(s) 49, 108
TasI AATT 2 cut(s) 88, 570
TatI WGTACW 1 cut(s) 1379
TauI GCSGC 4 cut(s) 62, 144, 398, 1081
TfiI GAWTC 4 cut(s) 222, 611, 1139, 1232
Tru1I TTAA 4 cut(s) 456, 1110, 1122, 1260
Tru9I TTAA 4 cut(s) 456, 1110, 1122, 1260
TscAI CASTG 2 cut(s) 562, 1188
TseFI GTSAC 2 cut(s) 559, 1439
TseI GCWGC 7 cut(s) 392, 437, 476, 681, 968, 971, 974
Tsp45I GTSAC 2 cut(s) 559, 1439
TspDTI ATGAA 5 cut(s) 61, 480, 820, 875, 1152
TspGWI ACGGA 2 cut(s) 329, 1062
TspRI CASTG 2 cut(s) 562, 1188
VpaK11BI GGWCC 2 cut(s) 114, 761
XagI CCTNNNNNAGG 1 cut(s) 636
XapI RAATTY 1 cut(s) 88
XceI RCATGY 1 cut(s) 1258
XcmI CCANNNNNNNNNTGG 1 cut(s) 811
XmiI GTMKAC 1 cut(s) 869
XmnI GAANNNNTTC 1 cut(s) 417
XspI CTAG 1 cut(s) 1383
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.