Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000220.1

Orthogroup ID

OG0005682

Physical Location & Seq

Genomic Coordinates Forward (+)

16086 .. 16418

Gene Structure 333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000220.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 333 bp

atgaatgtgggaactctcagaggaggtgctagagcattcaagatagacgcgcttctcaaacatgctgatgtgaaaggaactgatggaaagactaccttgttacactttgtggtgcaagaaataataagggctgaagggatcagagtttcggatagcataatgggtaggatgagccagaaaaacaaactcaagacaattgaagagaaggaagaagattatagaagaatggggctagaactcatctccggtctcagcactgaactctacaatgcaaagaagacgactacattggatttatacttcttgcaagtggtgttcttgcctatcccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003779 GO:0005488 GO:0005515 GO:0008092

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FH2

Protein Analysis

110

Amino Acids

12.38

Weight (kDa)

9.26

Isoelectric Point (pI)

34.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005682)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G05470
fragaria_vesca	FvH4_6g06480
malus_domestica	MD04G1201400.v1.1 MD12G1215100.v1.1
prunus_persica	Prupe.6G321600_v2.0.a1
pyrus_communis	pycom04g17740 pycom04g17750 pycom15g25860
rosa_chinensis	RchiOBHm_Chr3g0455601
rosa_laevigata	RLG00000025349
rosa_multiflora	Rmu_co8344379.1_g000001 Rmu_co8353267.1_g000001 Rmu_sc0000220.1_g000003 Rmu_sc0000223.1_g000001 Rmu_sc0005164.1_g000004 Rmu_sc0021585.1_g000001
rosa_roxburghii	Rroxscaffold_6G00423690 Rroxscaffold_6G00424180
rosa_rugosa	Rorug03G0008600 Rorug03G0008600
rosa_samantha	Rh2AG197000 Rh2DG204900 Rh3AG067900 Rh3BG070500 Rh3CG068800 Rh3DG070400 Rh7DG489800
rosa_wichuraiana	Rw3G005450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	50
AclWI	GGATC	1 cut(s)	146
AcuI	CTGAAG	1 cut(s)	153
AdeI	CACNNNGTG	1 cut(s)	109
AgsI	TTSAA	2 cut(s)	40, 200
Alw26I	GTCTC	1 cut(s)	254
AlwI	GGATC	1 cut(s)	146
AspLEI	GCGC	1 cut(s)	52
BbsI	GAAGAC	1 cut(s)	284
BccI	CCATC	1 cut(s)	77
BcoDI	GTCTC	1 cut(s)	254
BfaI	CTAG	2 cut(s)	30, 233
BpiI	GAAGAC	1 cut(s)	284
BpuEI	CTTGAG	1 cut(s)	173
BsaI	GGTCTC	1 cut(s)	254
BsaWI	WCCGGW	1 cut(s)	245
BseGI	GGATG	1 cut(s)	174
BseMII	CTCAG	2 cut(s)	31, 265
BseRI	GAGGAG	1 cut(s)	36
Bsh1236I	CGCG	1 cut(s)	50
BsiSI	CCGG	1 cut(s)	246
BsmAI	GTCTC	1 cut(s)	254
BsmI	GAATGC	1 cut(s)	35
Bso31I	GGTCTC	1 cut(s)	254
Bsp143I	GATC	1 cut(s)	138
BspCNI	CTCAG	2 cut(s)	30, 264
BspFNI	CGCG	1 cut(s)	50
BspPI	GGATC	1 cut(s)	146
BspTNI	GGTCTC	1 cut(s)	254
BssMI	GATC	1 cut(s)	138
Bst6I	CTCTTC	1 cut(s)	195
BstDEI	CTNAG	2 cut(s)	17, 251
BstF5I	GGATG	1 cut(s)	174
BstFNI	CGCG	1 cut(s)	50
BstHHI	GCGC	1 cut(s)	52
BstKTI	GATC	1 cut(s)	141
BstMAI	GTCTC	1 cut(s)	254
BstMBI	GATC	1 cut(s)	138
BstNSI	RCATGY	1 cut(s)	65
BstUI	CGCG	1 cut(s)	50
BstV2I	GAAGAC	1 cut(s)	284
BtsCI	GGATG	1 cut(s)	174
BtsIMutI	CAGTG	1 cut(s)	255
CfoI	GCGC	1 cut(s)	52
CseI	GACGC	1 cut(s)	56
CviAII	CATG	1 cut(s)	62
CviJI	RGCY	3 cut(s)	131, 174, 232
CviKI_1	RGCY	3 cut(s)	131, 174, 232
DdeI	CTNAG	2 cut(s)	17, 251
DpnI	GATC	1 cut(s)	140
DpnII	GATC	1 cut(s)	138
DraIII	CACNNNGTG	1 cut(s)	109
Eam1104I	CTCTTC	1 cut(s)	195
EarI	CTCTTC	1 cut(s)	195
Eco31I	GGTCTC	1 cut(s)	254
Eco57I	CTGAAG	1 cut(s)	153
FaeI	CATG	1 cut(s)	65
FaiI	YATR	5 cut(s)	63, 158, 219, 298, 331
FalI	AAGNNNNNCTT	2 cut(s)	80, 112
FatI	CATG	1 cut(s)	61
FokI	GGATG	1 cut(s)	181
FspBI	CTAG	2 cut(s)	30, 233
GlaI	GCGC	1 cut(s)	51
HapII	CCGG	1 cut(s)	246
HgaI	GACGC	1 cut(s)	56
HhaI	GCGC	1 cut(s)	52
Hin1II	CATG	1 cut(s)	65
Hin6I	GCGC	1 cut(s)	50
HinP1I	GCGC	1 cut(s)	50
HpaII	CCGG	1 cut(s)	246
Hpy188I	TCNGA	3 cut(s)	20, 143, 151
Hpy188III	TCNNGA	2 cut(s)	40, 190
HpyAV	CCTTC	2 cut(s)	128, 199
HpyCH4V	TGCA	3 cut(s)	115, 272, 307
HpyF3I	CTNAG	2 cut(s)	17, 251
Hsp92II	CATG	1 cut(s)	65
HspAI	GCGC	1 cut(s)	50
Kzo9I	GATC	1 cut(s)	138
LpnPI	CCDG	2 cut(s)	188, 259
MaeI	CTAG	2 cut(s)	30, 233
MaeIII	GTNAC	1 cut(s)	99
MalI	GATC	1 cut(s)	140
MboI	GATC	1 cut(s)	138
MboII	GAAGA	5 cut(s)	212, 221, 224, 234, 289
MfeI	CAATTG	1 cut(s)	195
MluCI	AATT	1 cut(s)	195
MnlI	CCTC	2 cut(s)	14, 17
MslI	CAYNNNNRTG	1 cut(s)	66
MspI	CCGG	1 cut(s)	246
MunI	CAATTG	1 cut(s)	195
Mva1269I	GAATGC	1 cut(s)	35
MvnI	CGCG	1 cut(s)	50
NdeII	GATC	1 cut(s)	138
NlaIII	CATG	1 cut(s)	65
NspI	RCATGY	1 cut(s)	65
PctI	GAATGC	1 cut(s)	35
RseI	CAYNNNNRTG	1 cut(s)	66
Sau3AI	GATC	1 cut(s)	138
SetI	ASST	2 cut(s)	28, 98
SmiMI	CAYNNNNRTG	1 cut(s)	66
SmlI	CTYRAG	1 cut(s)	188
SmoI	CTYRAG	1 cut(s)	188
Sse9I	AATT	1 cut(s)	195
SspMI	CTAG	2 cut(s)	30, 233
TasI	AATT	1 cut(s)	195
TscAI	CASTG	1 cut(s)	262
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	1 cut(s)	262
XceI	RCATGY	1 cut(s)	65
XspI	CTAG	2 cut(s)	30, 233

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.