Rmu_sc0000294.1_g000033

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000294.1
Physical Location & Seq
Forward (+)
170788 .. 171252
465 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000294.1_g000033.1.cds

Sequence Viewer

Length: 465 bp
ctgaagactttggtgcttgctgagtgcaatggcatcagtgatttttgggtctcgcatttgcggaatactcgagtcttagaagacttgaatttggatggatggttgagaaatgttagtaatattggagttagaaaaatatctggaattcaaaccctcaagaaattgaacttgagtcgactgcataaggtctccgaccaaagcatagttgctcttgctgagaattgcgtgagattggaggtgcttgatttgagtggttgtaaagtaacgagttatggcattagggcatttttcggtcacaggtgcttggaatctcttgttttggggtcgtactttcatatgcattggcttgatgtggaacacttagttctctgttgttggtcattgaagagtatcgtgctgaagaaagataatgtcaacttgaaggcaatgccagaaagtgttagcggaattgtgaggttggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

154

Amino Acids

17.37

Weight (kDa)

8.99

Isoelectric Point (pI)

28.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 175
AciI CCGC 2 cut(s) 61, 444
AcsI RAATTY 2 cut(s) 88, 144
AcuI CTGAAG 2 cut(s) 23, 419
AfaI GTAC 1 cut(s) 329
AgsI TTSAA 5 cut(s) 88, 149, 166, 385, 421
Alw26I GTCTC 2 cut(s) 55, 193
Ama87I CYCGRG 1 cut(s) 69
ApoI RAATTY 2 cut(s) 88, 144
AvaI CYCGRG 1 cut(s) 69
BbsI GAAGAC 2 cut(s) 11, 87
BccI CCATC 2 cut(s) 89, 93
BcoDI GTCTC 2 cut(s) 55, 193
BfaI CTAG 1 cut(s) 463
BmeT110I CYCGRG 1 cut(s) 69
BmsI GCATC 1 cut(s) 42
BpiI GAAGAC 2 cut(s) 11, 87
BpuEI CTTGAG 2 cut(s) 140, 190
BsaI GGTCTC 2 cut(s) 55, 193
Bse3DI GCAATG 2 cut(s) 34, 432
BseGI GGATG 2 cut(s) 100, 104
BseMI GCAATG 2 cut(s) 34, 432
BseMII CTCAG 2 cut(s) 12, 207
BsiHKCI CYCGRG 1 cut(s) 69
BsmAI GTCTC 2 cut(s) 55, 193
Bso31I GGTCTC 2 cut(s) 55, 193
BsoBI CYCGRG 1 cut(s) 69
BspACI CCGC 2 cut(s) 61, 444
BspCNI CTCAG 2 cut(s) 13, 208
BspTNI GGTCTC 2 cut(s) 55, 193
BsrDI GCAATG 2 cut(s) 34, 432
Bst6I CTCTTC 1 cut(s) 380
BstC8I GCNNGC 1 cut(s) 18
BstDEI CTNAG 4 cut(s) 21, 76, 216, 361
BstF5I GGATG 2 cut(s) 100, 104
BstMAI GTCTC 2 cut(s) 55, 193
BstV2I GAAGAC 2 cut(s) 11, 87
BtsCI GGATG 2 cut(s) 100, 104
BtsIMutI CAGTG 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 18
Csp6I GTAC 1 cut(s) 328
CviJI RGCY 1 cut(s) 346
CviKI_1 RGCY 1 cut(s) 346
CviQI GTAC 1 cut(s) 328
DdeI CTNAG 4 cut(s) 21, 76, 216, 361
Eam1104I CTCTTC 1 cut(s) 380
EarI CTCTTC 1 cut(s) 380
Eco31I GGTCTC 2 cut(s) 55, 193
Eco57I CTGAAG 2 cut(s) 23, 419
Eco88I CYCGRG 1 cut(s) 69
EcoRI GAATTC 1 cut(s) 144
EcoT22I ATGCAT 1 cut(s) 342
FaiI YATR 5 cut(s) 183, 203, 273, 336, 338
FauNDI CATATG 1 cut(s) 336
FblI GTMKAC 1 cut(s) 175
FokI GGATG 2 cut(s) 107, 111
FspBI CTAG 1 cut(s) 463
HincII GTYRAC 2 cut(s) 176, 415
HindII GTYRAC 2 cut(s) 176, 415
HinfI GANTC 3 cut(s) 72, 172, 308
Hpy166II GTNNAC 2 cut(s) 176, 415
Hpy188I TCNGA 1 cut(s) 193
Hpy188III TCNNGA 2 cut(s) 141, 157
Hpy8I GTNNAC 2 cut(s) 176, 415
HpyAV CCTTC 1 cut(s) 415
HpyCH4V TGCA 3 cut(s) 27, 181, 340
HpyF3I CTNAG 4 cut(s) 21, 76, 216, 361
LpnPI CCDG 3 cut(s) 126, 283, 444
LweI GCATC 1 cut(s) 42
MaeI CTAG 1 cut(s) 463
MaeIII GTNAC 2 cut(s) 262, 293
MboII GAAGA 4 cut(s) 16, 92, 397, 412
MluCI AATT 5 cut(s) 88, 144, 161, 220, 447
MlyI GAGTC 2 cut(s) 81, 181
MmeI TCCRAC 1 cut(s) 216
MnlI CCTC 3 cut(s) 164, 229, 447
Mph1103I ATGCAT 1 cut(s) 342
NdeI CATATG 1 cut(s) 336
NmuCI GTSAC 1 cut(s) 293
NsiI ATGCAT 1 cut(s) 342
PaeR7I CTCGAG 1 cut(s) 69
PfeI GAWTC 1 cut(s) 308
PleI GAGTC 2 cut(s) 80, 180
PpsI GAGTC 2 cut(s) 80, 180
PspXI VCTCGAGB 1 cut(s) 69
RsaI GTAC 1 cut(s) 329
RsaNI GTAC 1 cut(s) 328
SalI GTCGAC 1 cut(s) 174
SchI GAGTC 2 cut(s) 81, 181
SetI ASST 4 cut(s) 189, 240, 302, 458
SfaNI GCATC 1 cut(s) 42
Sfr274I CTCGAG 1 cut(s) 69
SlaI CTCGAG 1 cut(s) 69
SmlI CTYRAG 3 cut(s) 69, 155, 169
SmoI CTYRAG 3 cut(s) 69, 155, 169
Sse9I AATT 5 cut(s) 88, 144, 161, 220, 447
SsiI CCGC 2 cut(s) 61, 444
SspI AATATT 1 cut(s) 121
SspMI CTAG 1 cut(s) 463
TaqI TCGA 2 cut(s) 70, 175
TaqII GACCGA 1 cut(s) 281
TasI AATT 5 cut(s) 88, 144, 161, 220, 447
TfiI GAWTC 1 cut(s) 308
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 293
Tsp45I GTSAC 1 cut(s) 293
TspDTI ATGAA 1 cut(s) 323
TspRI CASTG 1 cut(s) 43
XapI RAATTY 2 cut(s) 88, 144
XhoI CTCGAG 1 cut(s) 69
XmiI GTMKAC 1 cut(s) 175
XspI CTAG 1 cut(s) 463
Zsp2I ATGCAT 1 cut(s) 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.