Rh6CG506200

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
66773039 .. 66773437
399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG506200.1

Sequence Viewer

Length: 399 bp
ATGCGTTGCTTAGAAGACTTGAATTTGGATGGATGTTTGAGAAATGTTAGTGATATTGGAGTTAGAAAAATATCTGGAATTCAAACCCTCAAGAAATTAAACTTGAGTCGACTGCATAAGGTCTCCGACCAAAGCATAGTTGCTCTTGCTGAGAATTGCGTGAGATTGGAGGTGCTTGATTTGAGTGGTTGTAAGGTAACGATTTATGTCATTAGGGCATTTTTCGGTCACAGGTGCTTGGAATCTCTTGTTTTGGGGTCGTACTTTCATCTGCGTTGGCTTGATGTGGAACACTTAGTTCTCGGTTGTTGGTCATTGAAGAGTATCGTGCTGAAGAAAGATAATGTCAACTTGAAGGCAATGCCAGAAAGTGTTAGCGGAATTGTGAGGTTGGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.85

Weight (kDa)

9.0

Isoelectric Point (pI)

29.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 109
AciI CCGC 1 cut(s) 378
AcsI RAATTY 2 cut(s) 22, 78
AcuI CTGAAG 1 cut(s) 353
AfaI GTAC 1 cut(s) 263
AgsI TTSAA 4 cut(s) 22, 83, 319, 355
Alw26I GTCTC 1 cut(s) 127
ApoI RAATTY 2 cut(s) 22, 78
BbsI GAAGAC 1 cut(s) 21
BccI CCATC 1 cut(s) 23
BcoDI GTCTC 1 cut(s) 127
BfaI CTAG 1 cut(s) 397
BpiI GAAGAC 1 cut(s) 21
BpuEI CTTGAG 2 cut(s) 74, 124
BsaI GGTCTC 1 cut(s) 127
Bse3DI GCAATG 1 cut(s) 366
BseGI GGATG 2 cut(s) 34, 38
BseMI GCAATG 1 cut(s) 366
BseMII CTCAG 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 127
Bso31I GGTCTC 1 cut(s) 127
BspACI CCGC 1 cut(s) 378
BspCNI CTCAG 1 cut(s) 142
BspTNI GGTCTC 1 cut(s) 127
BsrDI GCAATG 1 cut(s) 366
Bst6I CTCTTC 1 cut(s) 314
BstDEI CTNAG 3 cut(s) 10, 150, 295
BstF5I GGATG 2 cut(s) 34, 38
BstMAI GTCTC 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 21
BtsCI GGATG 2 cut(s) 34, 38
Csp6I GTAC 1 cut(s) 262
CviJI RGCY 1 cut(s) 280
CviKI_1 RGCY 1 cut(s) 280
CviQI GTAC 1 cut(s) 262
DdeI CTNAG 3 cut(s) 10, 150, 295
Eam1104I CTCTTC 1 cut(s) 314
EarI CTCTTC 1 cut(s) 314
Eco31I GGTCTC 1 cut(s) 127
Eco57I CTGAAG 1 cut(s) 353
EcoRI GAATTC 1 cut(s) 78
FaiI YATR 3 cut(s) 117, 137, 207
FblI GTMKAC 1 cut(s) 109
FokI GGATG 2 cut(s) 41, 45
FspBI CTAG 1 cut(s) 397
HincII GTYRAC 2 cut(s) 110, 349
HindII GTYRAC 2 cut(s) 110, 349
HinfI GANTC 2 cut(s) 106, 242
Hpy166II GTNNAC 2 cut(s) 110, 349
Hpy188I TCNGA 1 cut(s) 127
Hpy188III TCNNGA 2 cut(s) 75, 91
Hpy8I GTNNAC 2 cut(s) 110, 349
HpyAV CCTTC 1 cut(s) 349
HpyCH4V TGCA 1 cut(s) 115
HpyF3I CTNAG 3 cut(s) 10, 150, 295
LpnPI CCDG 3 cut(s) 60, 217, 378
MaeI CTAG 1 cut(s) 397
MaeIII GTNAC 2 cut(s) 196, 227
MboII GAAGA 3 cut(s) 26, 331, 346
MluCI AATT 5 cut(s) 22, 78, 95, 154, 381
MlyI GAGTC 1 cut(s) 115
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 3 cut(s) 98, 163, 381
MseI TTAA 1 cut(s) 98
NmuCI GTSAC 1 cut(s) 227
PfeI GAWTC 1 cut(s) 242
PleI GAGTC 1 cut(s) 114
PpsI GAGTC 1 cut(s) 114
RsaI GTAC 1 cut(s) 263
RsaNI GTAC 1 cut(s) 262
SalI GTCGAC 1 cut(s) 108
SaqAI TTAA 1 cut(s) 98
SchI GAGTC 1 cut(s) 115
SetI ASST 5 cut(s) 123, 174, 198, 236, 392
SmlI CTYRAG 2 cut(s) 89, 103
SmoI CTYRAG 2 cut(s) 89, 103
Sse9I AATT 5 cut(s) 22, 78, 95, 154, 381
SsiI CCGC 1 cut(s) 378
SspMI CTAG 1 cut(s) 397
TaqI TCGA 1 cut(s) 109
TaqII GACCGA 1 cut(s) 215
TasI AATT 5 cut(s) 22, 78, 95, 154, 381
TfiI GAWTC 1 cut(s) 242
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TseFI GTSAC 1 cut(s) 227
Tsp45I GTSAC 1 cut(s) 227
TspDTI ATGAA 1 cut(s) 257
XapI RAATTY 2 cut(s) 22, 78
XmiI GTMKAC 1 cut(s) 109
XspI CTAG 1 cut(s) 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.