Rmu_sc0000308.1_g000046
TCP Family

1-phosphatidylinositol-3-phosphate 5-kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000308.1
Physical Location & Seq
Forward (+)
198979 .. 207404
8426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000308.1_g000046.1.cds

Sequence Viewer

Length: 5691 bp
atggtgaaatcatggatcccttggcgatctgagccggctaatgtttcgagggatttttggatgcctgatgatagctgtagggtatgttatgagtgtgatgcacagttcactgtatttaaccgtaaacatcattgtagactttgtggacgagttttctgtgccaagtgtacagaaaactcaattcctgccccctctggtgactcaaggatagatcgggaagagagggaaaggattcgtgtctgcaatttttgttacaagcaacaacagcaaggcatagctgctactcctgataatggaacacagattgctaatctagatcttagtacctcaccatcagaaacaagttttactagctttaagtcatgcgccactggtaacagcagtagctttactcttaactcaatcccgtactcaactgggccataccaacgacttcaaaacagttctggtcttagcccctgtcaatcatctcccatgaaaacaagctcagaaaagcacagcaaatatgcctcctggaggaccaatgattttgttgcagatataggggattcatctccaaatcattatgagacttcaacaaccaggtttatatctcttttgtgcttgagcactggtaacagcagtagctttactcttaactcaatcccgtactcaactgggccataccaacgacttcaaaacagttctggtcttagcccctgccaatcatctcccatgaaaacaagctcagaaaagcacagcaaatatgcctcctggaggaccaatgattttgttgcagatataggggattcatctccaaatcattatgagatttcaacaaccagcatcaggagtgatgacgacgatgttgactatgggacatatcagtcagattctaagaattattctcaagtcaatgattactatggtcatgttgagttttatgagatgagcaatcatgatgaatcacataaagtgcaacttgatggtgaaaacattgatgcaaagcatttaagcagctccccgttgcttcacagttttaactcgcagggttcggatccaccacttgaaaagaaagaagatgaacatgatatgggtgatgaatgtgcttcctctttatgttctgctggggatgttgacgtagaacctgtggattttgagaacaatgcccttctttggcttccccctgaaccagaagatgaagaagatgaaagggaaactgttcttcttgatgatgacgatgatggtgatgctgcaggagagtggggaaccttacgcacatcaagcagttttggcagcggggagtctcgcaatagggatcgatcaggtgaggagcataagaaggtgatgaagaatgtggttgatgggcactttagggctttggtagctcagctattgcaggttgagaacctccctgtaggccaggaaggtgaaaatgaaagttggttggagatcattacgtatctgtcttgggaggctgctacactgttaaagccagatatgagcaaaggtggagggatggatcctggtggttatgtaaaagtaaaatgcatagcttctggacgcccctctgacagtatggtggtcaaaggagttgtctgtaagaaaaatgtggctcatcgacgaatggcatctaaaatggagaaacctcggttcatgattcttggtggtgctcttgagtaccagcgagtttctaacctattgtcaagttttgatacccttttacagcaggagatggaccatttaaagatggcagtagcaaagattgaagcgcaccaccctgatgtccttctggtagagaaatcagtttctcgatatgctcaggaatatcttcttgcaaaagacatatcacttgttcttaatatcaagaggccacttttagagcgcatagctcgctgcacaggtgctcaaatagttccatctatcgatcatctctcttcacaaaagttgggctactgtgagacatttcatgtggggaggtttctggaagatcttggttctgctggccagggtgggaagaaactggtgaagacattgatgtattttgaaggctgcccaaaaccattgggttgtactattttactcagaggtgccaatggggatgagttgaagaaagtgaagcatgtggttcagtatggggtttttgcagcatatcacttggctttggagacatccttccttgctgatgaaggtgcctctctgcctgaactcccattccagtctccaattactgtggcacttccagataaaccatcgagtattgagaggtccatctcaacagtacctggttttagaattggtgccaacgaaaagtctcagggagctcaacctcagagtgaaccacgaagagccaacagtgtcccgattacagattttgactcagcaattaagagtagaccaccatgtttactaactggtcgtagctctctacctgttcgtccgacttcaagttccacaaattctaccggtttacactctgccccacctgggaacggtgttacttttcatatcgctgataatcaaaatgaaatgggccccaaagattcttgggtggtggaaacttctgcaaccaaacctggctctgataatatgtctaatcatcttactgcaaatagcatgggatcttcagaggccctgggacaaggtatcttctccaatacccaaaatgatccaagtgtaaatcagctaggtagttcaggcaatccaatgctgcatcaagatggtcaaacccatgctgcagatgcaggaaccatgaatgaagagttccctccgtcacctgctgaccatcagagcattttagtttccttgtcatctcgatgcgtgtggaaggggactgtctgtgagaggtcacatctgttccgaattaaatactacggaagttttgataaacctttaggacggtttttgcgagaccatttatttgatcagacctatcaatgccattcttgcgagatgccatcagaggcacatgttcattgttatactcaccgacagggtacactcactatatctgttaagaggctgccagaaattttcttaccaggtgaaagggaagggaagatctggatgtggcacagatgtttgaggtgtccaaggatcagtggatttcctccagctactcggagaatagtgatgtctgatgctgcatggggtttgtcatttggtaagtttttggagctcagtttttcaaaccatgcggctgcaagcagggtggcgagctgtggccattccttacatagagattgtcttcgtttctatggatttgggaaaatggttgcttgctttcggtatgcatcgattgatgttcattctgtctaccttccaccctccaaactggatttcatttccgagaagcaggattggatacaaaaagaaactaatgaggttgttgcccgagcagagcttcttttctctgaagtacttaatgctcttagtcaaatttcagagaaaagatctggttcagggtcaattactagtggcattgtaacagctgaatccagacaccaaatagtggaactggaaggaatgttacagaaggagaaggtggaatttgaggagttacttcagaaaactttgaagagagaacctaagaagggccaacctgttatcgacattctggagatcaatcgattgcggaggcagttgttttttcaatcgtatatgtgggaccaccgcttggtttatgcagccagtttagataacaacagcttccaggatagtttgagcagctcaattccagctgaggataaacccgtggctactaatgaaaagcttgctgagatggatgtagaaataaagccaggaaaaggctataatagttgtgattcctatctggtggatgcaatgcttagtgatggctttgaccacgagggaggctttactagcgctgctatcaatgcagacatggttcatggagaggacaggagtgatgatttgaataaggaaaaaggtcaagctaatctccctactagcacaagtgtcggcgctcaatctgatcctttgacaccaaggacagctcttcgtagggtcctatctgatggtcagcatcctctcatgctgaatttgtcagatacccttgacactgcatggaccggcgaaaatctcattggagttgcgatagcaaaggagaactcgtgtccagttcctgacgtggccatagaaaattcttcaaatgccactccggcagagggattaaatttagaccatgcagaagcccaaaatgggaccaaagttgcccattatgtgtcacctgcattgtcgaccaaggggtctgagaatatggaagacacagttagctggttaaaaatgccctttttgaacttctaccgttcactaaataagaattttttatctgctgctcagaagttcgatacacttggtgggtacaatccagtctatgtgtcatcctttcgggagttggaactggaaggtggtgctaggctgctcttgcctgtgggtgaaaacgatactgttgtccctgtatatgatgatgagcccacaagtcttatagcctatgcccttgtttcatcagattatcagttacaaaccagtgatgagggggaaagagcaaaagacagtggggatattatggccacagcatcttttactgattcagtcattatgcatccagatgatgacactgtgtcagaaactcatagaagtcttgggtctactgaagagagcatactatcaatgtctggatctcgtggctccctgggtttggatccacttttatatacaaaggctttgcatgcaagagtgtcttttggagatgatggtcctcttggtaaggttaagtactctgtcacatgttattatgcaaagcgttttgaagccttaaggaagttgtgttgtccctctgagcttgattttgtaagatccctaagtcgttgtaaaaagtggggagcccaaggaggtaagagcaattggggagcccaaggaggtaagagcaatgtcttttttgcaaaaaccttggatgaccggtttatcgtcaaacaagtcaccaagacagagctggaatctttcattaaatttgcacctgcatatttcaagtacctctctgagtcaattagcacaggaagtccaacctgcctggcaaaaattctggggatatatcaggttatgtcgaagcatgttaagggaggcaaagaaacaaagatggatgttttgattatggagaatcttctgtttggaaggactgtaacacgactctatgatctcaaaggatcttcgcggtcaaggtataatcctgattctagtgggagtaacaaggttcttctggatcagaacttgattgaagcaatgccaacatctccaatcttcgtgggaaacaaggcaaagcggctgttggagagagctgtctggaatgataccgctttccttgcctcaattgatgtgatggattattcattactggtcggggtggatgaagagaagcatgagctagtacttgggatcattgatttcatgaggcagtatacatgggataagcaccttgaaacgtgggttaaagcttcaggaatccttggtgggccaaagaacgcatctccgactgtaatttcaccaaagcaatacaaaaaaaggttcaggaaggccatgacaacctattttctgatggttccagatcagtggtctcctccatctattgttccaagtacatcccagtctgatatcggtgaagagaatgcacacggtggtgcctctgttgaatga

Protein Analysis

1896

Amino Acids

209.47

Weight (kDa)

5.7

Isoelectric Point (pI)

47.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 3 cut(s) 2764, 4237, 5026
AasI GACNNNNNNGTC 2 cut(s) 865, 4246
Acc36I ACCTGC 5 cut(s) 1369, 2764, 4237, 5026, 5075
AccB1I GGYRCC 4 cut(s) 2069, 2171, 2279, 5675
AccB7I CCANNNNNTGG 2 cut(s) 3490, 3655
AccI GTMKAC 6 cut(s) 136, 2374, 3294, 4238, 4649, 5456
AccII CGCG 1 cut(s) 5212
AciI CCGC 7 cut(s) 1278, 3176, 3613, 3652, 5212, 5320, 5352
AcoI YGGCCR 4 cut(s) 1984, 3202, 4131, 4569
AcuI CTGAAG 5 cut(s) 2589, 3414, 3527, 4674, 5478
AcyI GRCGYC 1 cut(s) 1543
AdeI CACNNNGTG 2 cut(s) 4358, 5672
AfeI AGCGCT 1 cut(s) 3865
AflII CTTAAG 1 cut(s) 4816
AflIII ACRYGT 2 cut(s) 2947, 4787
AgeI ACCGGT 2 cut(s) 2444, 4959
AhdI GACNNNNNGTC 1 cut(s) 4621
AhlI ACTAGT 1 cut(s) 3452
AjiI CACGTC 1 cut(s) 4129
AjuI GAANNNNNNNTTGG 4 cut(s) 3302, 3334, 4068, 4100
AleI CACNNNNGTG 1 cut(s) 5673
AloI GAACNNNNNNTCC 2 cut(s) 2178, 2210
Alw21I GWGCWC 5 cut(s) 611, 1654, 1888, 2305, 3159
Alw26I GTCTC 8 cut(s) 563, 1290, 1934, 2141, 2205, 2298, 2883, 5616
AlwNI CAGNNNCTG 2 cut(s) 2264, 4124
Ama87I CYCGRG 1 cut(s) 3372
Aor51HI AGCGCT 1 cut(s) 3865
ApaI GGGCCC 1 cut(s) 2516
ArsI GACNNNNNNTTYG 4 cut(s) 1560, 1592, 2882, 2914
AsiGI ACCGGT 2 cut(s) 2444, 4959
Asp700I GAANNNNTTC 3 cut(s) 231, 1200, 1809
AspLEI GCGC 5 cut(s) 368, 1753, 1866, 3866, 3965
AvaI CYCGRG 1 cut(s) 3372
AvaII GGWCC 9 cut(s) 519, 759, 1717, 2247, 3646, 4006, 4068, 4203, 4757
BaeGI GKGCMC 2 cut(s) 1350, 2516
BaeI ACNNNNGTAYC 2 cut(s) 4437, 4470
BalI TGGCCA 4 cut(s) 1986, 3204, 4133, 4571
BamHI GGATCC 4 cut(s) 15, 1036, 1501, 4702
BanI GGYRCC 4 cut(s) 2069, 2171, 2279, 5675
BanII GRGCYC 6 cut(s) 2305, 2516, 3159, 4476, 4888, 4915
BarI GAAGNNNNNNTAC 4 cut(s) 3492, 3524, 4647, 4679
BauI CACGAG 3 cut(s) 3845, 4111, 4683
BbsI GAAGAC 3 cut(s) 2015, 3218, 4269
Bbv12I GWGCWC 5 cut(s) 611, 1654, 1888, 2305, 3159
BbvCI CCTCAGC 1 cut(s) 3720
BcgI CGANNNNNNTGC 2 cut(s) 3940, 3974
BciVI GTATCC 1 cut(s) 3336
BclI TGATCA 1 cut(s) 2902
BcoDI GTCTC 8 cut(s) 563, 1290, 1934, 2141, 2205, 2298, 2883, 5616
BcuI ACTAGT 1 cut(s) 3452
BfaI CTAG 9 cut(s) 314, 351, 2666, 3453, 3861, 3948, 4416, 5235, 5423
BfmI CTRYAG 4 cut(s) 76, 1233, 1395, 2715
BfoI RGCGCY 2 cut(s) 3867, 3966
BfrI CTTAAG 1 cut(s) 4816
BfuAI ACCTGC 5 cut(s) 1369, 2764, 4237, 5026, 5075
BfuI GTATCC 1 cut(s) 3336
BglI GCCNNNNNGGC 1 cut(s) 4160
BglII AGATCT 4 cut(s) 316, 1969, 3039, 3431
BlpI GCTNAGC 1 cut(s) 1368
BmcAI AGTACT 3 cut(s) 3399, 4778, 5427
Bme18I GGWCC 9 cut(s) 519, 759, 1717, 2247, 3646, 4006, 4068, 4203, 4757
BmeRI GACNNNNNGTC 1 cut(s) 4621
BmeT110I CYCGRG 1 cut(s) 3372
BmgBI CACGTC 1 cut(s) 4129
BmrI ACTGGG 3 cut(s) 426, 666, 5635
BmuI ACTGGG 3 cut(s) 426, 666, 5635
BpiI GAAGAC 3 cut(s) 2015, 3218, 4269
BpmI CTGGAG 4 cut(s) 535, 775, 3075, 3617
Bpu10I CCTNAGC 2 cut(s) 1800, 3720
Bpu1102I GCTNAGC 1 cut(s) 1368
BpuEI CTTGAG 4 cut(s) 187, 625, 873, 1676
Bsa29I ATCGAT 4 cut(s) 1300, 1905, 3275, 3607
BsaAI YACGTR 1 cut(s) 1440
BsaBI GATNNNNATC 1 cut(s) 3807
BsaHI GRCGYC 1 cut(s) 1543
BsaI GGTCTC 2 cut(s) 2883, 5616
BsaWI WCCGGW 2 cut(s) 2444, 4959
BsaXI ACNNNNNCTCC 2 cut(s) 4097, 4127
Bse118I RCCGGY 4 cut(s) 34, 2444, 4070, 4959
Bse3DI GCAATG 3 cut(s) 3828, 4936, 5286
Bse8I GATNNNNATC 1 cut(s) 3807
BseCI ATCGAT 4 cut(s) 1300, 1905, 3275, 3607
BseJI GATNNNNATC 1 cut(s) 3807
BseMI GCAATG 3 cut(s) 3828, 4936, 5286
BseRI GAGGAG 3 cut(s) 1325, 3548, 5604
BseSI GKGCMC 2 cut(s) 1350, 2516
BseYI CCCAGC 1 cut(s) 1106
BsgI GTGCAG 1 cut(s) 1861
Bsh1236I CGCG 1 cut(s) 5212
BshNI GGYRCC 4 cut(s) 2069, 2171, 2279, 5675
BshTI ACCGGT 2 cut(s) 2444, 4959
BshVI ATCGAT 4 cut(s) 1300, 1905, 3275, 3607
BsiHKAI GWGCWC 5 cut(s) 611, 1654, 1888, 2305, 3159
BsiHKCI CYCGRG 1 cut(s) 3372
BsiSI CCGG 5 cut(s) 35, 2445, 4071, 4160, 4960
BslFI GGGAC 8 cut(s) 871, 2324, 2631, 2824, 3659, 4216, 4439, 4818
BsmAI GTCTC 8 cut(s) 563, 1290, 1934, 2141, 2205, 2298, 2883, 5616
BsmFI GGGAC 8 cut(s) 871, 2324, 2631, 2824, 3659, 4216, 4439, 4818
BsmI GAATGC 1 cut(s) 5668
Bso31I GGTCTC 2 cut(s) 2883, 5616
BsoBI CYCGRG 1 cut(s) 3372
Bsp120I GGGCCC 1 cut(s) 2512
Bsp1407I TGTACA 1 cut(s) 167
Bsp1720I GCTNAGC 1 cut(s) 1368
BspACI CCGC 7 cut(s) 1278, 3176, 3613, 3652, 5212, 5320, 5352
BspDI ATCGAT 4 cut(s) 1300, 1905, 3275, 3607
BspFNI CGCG 1 cut(s) 5212
BspHI TCATGA 3 cut(s) 937, 1635, 5445
BspMAI CTGCAG 2 cut(s) 1237, 2719
BspMI ACCTGC 5 cut(s) 1369, 2764, 4237, 5026, 5075
BspQI GCTCTTC 2 cut(s) 2320, 4002
BspT107I GGYRCC 4 cut(s) 2069, 2171, 2279, 5675
BspTI CTTAAG 1 cut(s) 4816
BspTNI GGTCTC 2 cut(s) 2883, 5616
BsrDI GCAATG 3 cut(s) 3828, 4936, 5286
BsrFI RCCGGY 4 cut(s) 34, 2444, 4070, 4959
BsrGI TGTACA 1 cut(s) 167
BssAI RCCGGY 4 cut(s) 34, 2444, 4070, 4959
BssNAI GTATAC 1 cut(s) 5457
BssNI GRCGYC 1 cut(s) 1543
BssSI CACGAG 3 cut(s) 3845, 4111, 4683
BssT1I CCWWGG 8 cut(s) 20, 3071, 3986, 4242, 4888, 4915, 4950, 5503
Bst1107I GTATAC 1 cut(s) 5457
Bst2BI CACGAG 3 cut(s) 3845, 4111, 4683
Bst6I CTCTTC 9 cut(s) 213, 1921, 2320, 2733, 3551, 4002, 4650, 5403, 5652
BstACI GRCGYC 1 cut(s) 1543
BstAFI CTTAAG 1 cut(s) 4816
BstAUI TGTACA 1 cut(s) 167
BstBAI YACGTR 1 cut(s) 1440
BstC8I GCNNGC 8 cut(s) 36, 1873, 1984, 3184, 3196, 3259, 3753, 4731
BstDSI CCRYGG 1 cut(s) 3732
BstENI CCTNNNNNAGG 2 cut(s) 514, 754
BstFNI CGCG 1 cut(s) 5212
BstH2I RGCGCY 2 cut(s) 3867, 3966
BstHHI GCGC 5 cut(s) 368, 1753, 1866, 3866, 3965
BstMAI GTCTC 8 cut(s) 563, 1290, 1934, 2141, 2205, 2298, 2883, 5616
BstNSI RCATGY 5 cut(s) 2105, 2951, 4733, 4791, 5114
BstSFI CTRYAG 4 cut(s) 76, 1233, 1395, 2715
BstSLI GKGCMC 2 cut(s) 1350, 2516
BstSNI TACGTA 1 cut(s) 1440
BstUI CGCG 1 cut(s) 5212
BstV2I GAAGAC 3 cut(s) 2015, 3218, 4269
BstXI CCANNNNNNTGG 1 cut(s) 5607
BstZ17I GTATAC 1 cut(s) 5457
Bsu15I ATCGAT 4 cut(s) 1300, 1905, 3275, 3607
BsuI GTATCC 1 cut(s) 3336
BsuTUI ATCGAT 4 cut(s) 1300, 1905, 3275, 3607
BtgI CCRYGG 1 cut(s) 3732
BtrI CACGTC 1 cut(s) 4129
BtsI GCAGTG 1 cut(s) 4059
BveI ACCTGC 5 cut(s) 1369, 2764, 4237, 5026, 5075
Cac8I GCNNGC 8 cut(s) 36, 1873, 1984, 3184, 3196, 3259, 3753, 4731
CaiI CAGNNNCTG 2 cut(s) 2264, 4124
CciI TCATGA 3 cut(s) 937, 1635, 5445
CfoI GCGC 5 cut(s) 368, 1753, 1866, 3866, 3965
Cfr10I RCCGGY 4 cut(s) 34, 2444, 4070, 4959
ClaI ATCGAT 4 cut(s) 1300, 1905, 3275, 3607
CseI GACGC 1 cut(s) 1551
CsiI ACCWGGT 3 cut(s) 581, 2263, 3019
CspAI ACCGGT 2 cut(s) 2444, 4959
CspCI CAANNNNNGTGG 6 cut(s) 2193, 2228, 3171, 3206, 5283, 5318
DraI TTTAAA 1 cut(s) 1725
DraIII CACNNNGTG 2 cut(s) 4358, 5672
DrdI GACNNNNNNGTC 2 cut(s) 865, 4246
DriI GACNNNNNGTC 1 cut(s) 4621
DseDI GACNNNNNNGTC 2 cut(s) 865, 4246
EaeI YGGCCR 4 cut(s) 1984, 3202, 4131, 4569
Eam1104I CTCTTC 9 cut(s) 213, 1921, 2320, 2733, 3551, 4002, 4650, 5403, 5652
Eam1105I GACNNNNNGTC 1 cut(s) 4621
EarI CTCTTC 9 cut(s) 213, 1921, 2320, 2733, 3551, 4002, 4650, 5403, 5652
Ecl136II GAGCTC 2 cut(s) 2303, 3157
Eco105I TACGTA 1 cut(s) 1440
Eco130I CCWWGG 8 cut(s) 20, 3071, 3986, 4242, 4888, 4915, 4950, 5503
Eco24I GRGCYC 6 cut(s) 2305, 2516, 3159, 4476, 4888, 4915
Eco31I GGTCTC 2 cut(s) 2883, 5616
Eco32I GATATC 1 cut(s) 5650
Eco47I GGWCC 9 cut(s) 519, 759, 1717, 2247, 3646, 4006, 4068, 4203, 4757
Eco47III AGCGCT 1 cut(s) 3865
Eco53kI GAGCTC 2 cut(s) 2303, 3157
Eco57I CTGAAG 5 cut(s) 2589, 3414, 3527, 4674, 5478
Eco88I CYCGRG 1 cut(s) 3372
EcoICRI GAGCTC 2 cut(s) 2303, 3157
EcoNI CCTNNNNNAGG 2 cut(s) 514, 754
EcoO109I RGGNCCY 3 cut(s) 2513, 2611, 4006
EcoRV GATATC 1 cut(s) 5650
EcoT14I CCWWGG 8 cut(s) 20, 3071, 3986, 4242, 4888, 4915, 4950, 5503
EcoT22I ATGCAT 3 cut(s) 1532, 3274, 4605
EcoT38I GRGCYC 6 cut(s) 2305, 2516, 3159, 4476, 4888, 4915
ErhI CCWWGG 8 cut(s) 20, 3071, 3986, 4242, 4888, 4915, 4950, 5503
FalI AAGNNNNNCTT 4 cut(s) 945, 977, 4726, 4758
FaqI GGGAC 8 cut(s) 871, 2324, 2631, 2824, 3659, 4216, 4439, 4818
FauI CCCGC 1 cut(s) 1271
FbaI TGATCA 1 cut(s) 2902
FblI GTMKAC 6 cut(s) 136, 2374, 3294, 4238, 4649, 5456
FriOI GRGCYC 6 cut(s) 2305, 2516, 3159, 4476, 4888, 4915
FspBI CTAG 9 cut(s) 314, 351, 2666, 3453, 3861, 3948, 4416, 5235, 5423
GlaI GCGC 5 cut(s) 367, 1752, 1865, 3865, 3964
GsaI CCCAGC 1 cut(s) 1110
GsuI CTGGAG 4 cut(s) 535, 775, 3075, 3617
HaeII RGCGCY 2 cut(s) 3867, 3966
HapII CCGG 5 cut(s) 35, 2445, 4071, 4160, 4960
HgaI GACGC 1 cut(s) 1551
HhaI GCGC 5 cut(s) 368, 1753, 1866, 3866, 3965
Hin1I GRCGYC 1 cut(s) 1543
Hin6I GCGC 5 cut(s) 366, 1751, 1864, 3864, 3963
HinP1I GCGC 5 cut(s) 366, 1751, 1864, 3864, 3963
HincII GTYRAC 3 cut(s) 850, 1117, 4239
HindII GTYRAC 3 cut(s) 850, 1117, 4239
HindIII AAGCTT 2 cut(s) 3749, 5490
HpaII CCGG 5 cut(s) 35, 2445, 4071, 4160, 4960
Hpy99I CGWCG 2 cut(s) 845, 1605
HpyCH4IV ACGT 4 cut(s) 1119, 1439, 4128, 5480
HpySE526I ACGT 4 cut(s) 1119, 1439, 4128, 5480
Hsp92I GRCGYC 1 cut(s) 1543
HspAI GCGC 5 cut(s) 366, 1751, 1864, 3864, 3963
KroI GCCGGC 1 cut(s) 34
KroNI GCCGGC 1 cut(s) 36
Ksp22I TGATCA 1 cut(s) 2902
LguI GCTCTTC 2 cut(s) 2320, 4002
LmnI GCTCC 7 cut(s) 1004, 1312, 2300, 3154, 4694, 4883, 4910
MabI ACCWGGT 3 cut(s) 581, 2263, 3019
MaeI CTAG 9 cut(s) 314, 351, 2666, 3453, 3861, 3948, 4416, 5235, 5423
MaeII ACGT 4 cut(s) 1119, 1439, 4128, 5480
MfeI CAATTG 2 cut(s) 4903, 5367
MlsI TGGCCA 4 cut(s) 1986, 3204, 4133, 4571
MluNI TGGCCA 4 cut(s) 1986, 3204, 4133, 4571
MlyI GAGTC 5 cut(s) 194, 1292, 2351, 5051, 5181
MmeI TCCRAC 6 cut(s) 1407, 2444, 4377, 5087, 5307, 5552
Mox20I TGGCCA 4 cut(s) 1986, 3204, 4133, 4571
Mph1103I ATGCAT 3 cut(s) 1532, 3274, 4605
MroNI GCCGGC 1 cut(s) 34
MroXI GAANNNNTTC 3 cut(s) 231, 1200, 1809
MscI TGGCCA 4 cut(s) 1986, 3204, 4133, 4571
MslI CAYNNNNRTG 5 cut(s) 1761, 2697, 2794, 4608, 5673
Msp20I TGGCCA 4 cut(s) 1986, 3204, 4133, 4571
MspA1I CMGCKG 3 cut(s) 1278, 3470, 3719
MspCI CTTAAG 1 cut(s) 4816
MspI CCGG 5 cut(s) 35, 2445, 4071, 4160, 4960
MunI CAATTG 2 cut(s) 4903, 5367
Mva1269I GAATGC 1 cut(s) 5668
MvnI CGCG 1 cut(s) 5212
NaeI GCCGGC 1 cut(s) 36
NgoMIV GCCGGC 1 cut(s) 34
NmuCI GTSAC 6 cut(s) 197, 2751, 2826, 4224, 4783, 4978
NsiI ATGCAT 3 cut(s) 1532, 3274, 4605
NspI RCATGY 5 cut(s) 2105, 2951, 4733, 4791, 5114
OliI CACNNNNGTG 1 cut(s) 5673
PaeI GCATGC 1 cut(s) 4733
PagI TCATGA 3 cut(s) 937, 1635, 5445
PaqCI CACCTGC 3 cut(s) 2764, 4237, 5026
PasI CCCWGGG 2 cut(s) 2614, 4693
PciI ACATGT 2 cut(s) 2947, 4787
PciSI GCTCTTC 2 cut(s) 2320, 4002
PcsI WCGNNNNNNNCGW 1 cut(s) 2884
PctI GAATGC 1 cut(s) 5668
PdiI GCCGGC 1 cut(s) 36
PdmI GAANNNNTTC 3 cut(s) 231, 1200, 1809
PflMI CCANNNNNTGG 2 cut(s) 3490, 3655
PfoI TCCNGGA 3 cut(s) 512, 752, 3690
PinAI ACCGGT 2 cut(s) 2444, 4959
PleI GAGTC 5 cut(s) 194, 1291, 2351, 5050, 5181
PpsI GAGTC 5 cut(s) 194, 1291, 2351, 5050, 5181
Ppu21I YACGTR 1 cut(s) 1440
PpuMI RGGWCCY 1 cut(s) 4006
PscI ACATGT 2 cut(s) 2947, 4787
Psp124BI GAGCTC 2 cut(s) 2305, 3159
Psp5II RGGWCCY 1 cut(s) 4006
PspFI CCCAGC 1 cut(s) 1106
PspOMI GGGCCC 1 cut(s) 2512
PspPPI RGGWCCY 1 cut(s) 4006
PstI CTGCAG 2 cut(s) 1237, 2719
PstNI CAGNNNCTG 2 cut(s) 2264, 4124
PvuII CAGCTG 2 cut(s) 3470, 3719
RseI CAYNNNNRTG 5 cut(s) 1761, 2697, 2794, 4608, 5673
SacI GAGCTC 2 cut(s) 2305, 3159
SalI GTCGAC 1 cut(s) 4237
SapI GCTCTTC 2 cut(s) 2320, 4002
ScaI AGTACT 3 cut(s) 3399, 4778, 5427
SchI GAGTC 5 cut(s) 194, 1292, 2351, 5051, 5181
SexAI ACCWGGT 3 cut(s) 581, 2263, 3019
SfcI CTRYAG 4 cut(s) 76, 1233, 1395, 2715
SinI GGWCC 9 cut(s) 519, 759, 1717, 2247, 3646, 4006, 4068, 4203, 4757
SmiMI CAYNNNNRTG 5 cut(s) 1761, 2697, 2794, 4608, 5673
SmlI CTYRAG 5 cut(s) 202, 604, 888, 1655, 4816
SmoI CTYRAG 5 cut(s) 202, 604, 888, 1655, 4816
SnaBI TACGTA 1 cut(s) 1440
SpeI ACTAGT 1 cut(s) 3452
SphI GCATGC 1 cut(s) 4733
SsiI CCGC 7 cut(s) 1278, 3176, 3613, 3652, 5212, 5320, 5352
SspMI CTAG 9 cut(s) 314, 351, 2666, 3453, 3861, 3948, 4416, 5235, 5423
SstI GAGCTC 2 cut(s) 2305, 3159
StyI CCWWGG 8 cut(s) 20, 3071, 3986, 4242, 4888, 4915, 4950, 5503
TaiI ACGT 4 cut(s) 1122, 1442, 4131, 5483
TatI WGTACW 6 cut(s) 167, 2051, 3397, 4776, 5425, 5633
TauI GCSGC 2 cut(s) 3179, 5323
TseFI GTSAC 6 cut(s) 197, 2751, 2826, 4224, 4783, 4978
Tsp45I GTSAC 6 cut(s) 197, 2751, 2826, 4224, 4783, 4978
TspGWI ACGGA 2 cut(s) 2739, 2868
Van91I CCANNNNNTGG 2 cut(s) 3490, 3655
Vha464I CTTAAG 1 cut(s) 4816
VpaK11BI GGWCC 9 cut(s) 519, 759, 1717, 2247, 3646, 4006, 4068, 4203, 4757
XagI CCTNNNNNAGG 2 cut(s) 514, 754
XbaI TCTAGA 1 cut(s) 313
XceI RCATGY 5 cut(s) 2105, 2951, 4733, 4791, 5114
XcmI CCANNNNNNNNNTGG 1 cut(s) 4990
XmiI GTMKAC 6 cut(s) 136, 2374, 3294, 4238, 4649, 5456
XmnI GAANNNNTTC 3 cut(s) 231, 1200, 1809
XspI CTAG 9 cut(s) 314, 351, 2666, 3453, 3861, 3948, 4416, 5235, 5423
ZrmI AGTACT 3 cut(s) 3399, 4778, 5427
Zsp2I ATGCAT 3 cut(s) 1532, 3274, 4605
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.