Rmu_sc0000410.1_g000005

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000410.1
OG0017398
Physical Location & Seq
Forward (+)
26674 .. 27048
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000410.1_g000005.1.cds

Sequence Viewer

Length: 375 bp
atgaatgcgcagttgacaagaccatatgacggggcagaaatagagcaagcacttaagaaaatgaccccattgaagtccccgagtttggatggcctaccagccaccttttaccaaaagtattggcacatagttgggaatgatgtagttgatggctgtttagagatactgaatggcaataaatcagttcaatctctgaatcatacggtaatagcactcattccaaaggtggaggagccaatattggtcgcgcagtacacacccattgcattgtgtaatgtcataaataagcttgtggccaagactatagcaaataggttcaagaaagtgttacccaaggtgatcagtgagactcaaagtgcatttgttcccaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

124

Amino Acids

13.7

Weight (kDa)

9.12

Isoelectric Point (pI)

50.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 9
AccII CGCG 1 cut(s) 248
AcoI YGGCCR 1 cut(s) 294
AfaI GTAC 1 cut(s) 254
AfiI CCNNNNNNNGG 2 cut(s) 29, 85
AflII CTTAAG 1 cut(s) 53
AgsI TTSAA 3 cut(s) 73, 188, 319
AluBI AGCT 1 cut(s) 289
AluI AGCT 1 cut(s) 289
Alw26I GTCTC 1 cut(s) 341
Ama87I CYCGRG 1 cut(s) 79
AoxI GGCC 2 cut(s) 91, 294
AspLEI GCGC 2 cut(s) 10, 250
AsuHPI GGTGA 1 cut(s) 349
AvaI CYCGRG 1 cut(s) 79
BalI TGGCCA 1 cut(s) 296
BccI CCATC 2 cut(s) 83, 143
BclI TGATCA 1 cut(s) 339
BcoDI GTCTC 1 cut(s) 341
BfmI CTRYAG 1 cut(s) 303
BfrI CTTAAG 1 cut(s) 53
BmeT110I CYCGRG 1 cut(s) 79
BmiI GGNNCC 1 cut(s) 234
BsaJI CCNNGG 1 cut(s) 333
Bsc4I CCNNNNNNNGG 2 cut(s) 29, 85
Bse3DI GCAATG 1 cut(s) 261
BseDI CCNNGG 1 cut(s) 333
BseGI GGATG 1 cut(s) 94
BseLI CCNNNNNNNGG 2 cut(s) 29, 85
BseMI GCAATG 1 cut(s) 261
BseRI GAGGAG 1 cut(s) 245
Bsh1236I CGCG 1 cut(s) 248
BshFI GGCC 2 cut(s) 93, 296
BsiHKCI CYCGRG 1 cut(s) 79
BslFI GGGAC 1 cut(s) 61
BslI CCNNNNNNNGG 2 cut(s) 29, 85
BsmAI GTCTC 1 cut(s) 341
BsmFI GGGAC 1 cut(s) 61
BsmI GAATGC 1 cut(s) 10
BsnI GGCC 2 cut(s) 93, 296
BsoBI CYCGRG 1 cut(s) 79
Bsp143I GATC 1 cut(s) 339
BspANI GGCC 2 cut(s) 93, 296
BspFNI CGCG 1 cut(s) 248
BspLI GGNNCC 1 cut(s) 234
BspTI CTTAAG 1 cut(s) 53
BsrDI GCAATG 1 cut(s) 261
BssECI CCNNGG 1 cut(s) 333
BssMI GATC 1 cut(s) 339
BssT1I CCWWGG 1 cut(s) 333
Bst4CI ACNGT 1 cut(s) 205
BstAFI CTTAAG 1 cut(s) 53
BstC8I GCNNGC 1 cut(s) 48
BstF5I GGATG 1 cut(s) 94
BstFNI CGCG 1 cut(s) 248
BstHHI GCGC 2 cut(s) 10, 250
BstKTI GATC 1 cut(s) 342
BstMAI GTCTC 1 cut(s) 341
BstMBI GATC 1 cut(s) 339
BstSFI CTRYAG 1 cut(s) 303
BstUI CGCG 1 cut(s) 248
BsuRI GGCC 2 cut(s) 93, 296
BtsCI GGATG 1 cut(s) 94
BtsIMutI CAGTG 1 cut(s) 349
Cac8I GCNNGC 1 cut(s) 48
CfoI GCGC 2 cut(s) 10, 250
Csp6I GTAC 1 cut(s) 253
CviJI RGCY 6 cut(s) 93, 101, 153, 235, 289, 296
CviKI_1 RGCY 6 cut(s) 93, 101, 153, 235, 289, 296
CviQI GTAC 1 cut(s) 253
DpnI GATC 1 cut(s) 341
DpnII GATC 1 cut(s) 339
EaeI YGGCCR 1 cut(s) 294
Eco130I CCWWGG 1 cut(s) 333
Eco88I CYCGRG 1 cut(s) 79
EcoT14I CCWWGG 1 cut(s) 333
ErhI CCWWGG 1 cut(s) 333
FaiI YATR 6 cut(s) 25, 27, 128, 201, 281, 305
FaqI GGGAC 1 cut(s) 61
FauNDI CATATG 1 cut(s) 25
FbaI TGATCA 1 cut(s) 339
FokI GGATG 1 cut(s) 101
FspI TGCGCA 1 cut(s) 9
GlaI GCGC 2 cut(s) 9, 249
HaeIII GGCC 2 cut(s) 93, 296
HhaI GCGC 2 cut(s) 10, 250
Hin6I GCGC 2 cut(s) 8, 248
HinP1I GCGC 2 cut(s) 8, 248
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
HindIII AAGCTT 1 cut(s) 287
HinfI GANTC 2 cut(s) 196, 349
HphI GGTGA 1 cut(s) 349
Hpy166II GTNNAC 2 cut(s) 15, 255
Hpy188I TCNGA 1 cut(s) 195
Hpy188III TCNNGA 1 cut(s) 319
Hpy8I GTNNAC 2 cut(s) 15, 255
HpyCH4III ACNGT 1 cut(s) 205
HpyCH4V TGCA 2 cut(s) 266, 359
HspAI GCGC 2 cut(s) 8, 248
Ksp22I TGATCA 1 cut(s) 339
Kzo9I GATC 1 cut(s) 339
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 327
MalI GATC 1 cut(s) 341
MboI GATC 1 cut(s) 339
MlsI TGGCCA 1 cut(s) 296
MluNI TGGCCA 1 cut(s) 296
MlyI GAGTC 1 cut(s) 343
MnlI CCTC 1 cut(s) 223
Mox20I TGGCCA 1 cut(s) 296
MscI TGGCCA 1 cut(s) 296
MseI TTAA 1 cut(s) 54
Msp20I TGGCCA 1 cut(s) 296
MspCI CTTAAG 1 cut(s) 53
Mva1269I GAATGC 1 cut(s) 10
MvnI CGCG 1 cut(s) 248
NdeI CATATG 1 cut(s) 25
NdeII GATC 1 cut(s) 339
NlaIV GGNNCC 1 cut(s) 234
NsbI TGCGCA 1 cut(s) 9
PctI GAATGC 1 cut(s) 10
PfeI GAWTC 1 cut(s) 196
PleI GAGTC 1 cut(s) 343
PpsI GAGTC 1 cut(s) 343
PspN4I GGNNCC 1 cut(s) 234
RsaI GTAC 1 cut(s) 254
RsaNI GTAC 1 cut(s) 253
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 339
SchI GAGTC 1 cut(s) 343
SetI ASST 5 cut(s) 107, 228, 291, 317, 339
SfcI CTRYAG 1 cut(s) 303
SmlI CTYRAG 1 cut(s) 53
SmoI CTYRAG 1 cut(s) 53
SspI AATATT 1 cut(s) 240
StyI CCWWGG 1 cut(s) 333
TaaI ACNGT 1 cut(s) 205
TatI WGTACW 1 cut(s) 252
TfiI GAWTC 1 cut(s) 196
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 1 cut(s) 349
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 349
Vha464I CTTAAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.