Rh5AG330700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0017398
Physical Location & Seq
Forward (+)
50937412 .. 50951727
14316 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG330700.1

Sequence Viewer

Length: 294 bp
ATGGGTGGTAACACGGTAGAGGCCTTCCAATACATCCAACAAAATGGTGGAATGACCATCATTGGTGAAGATAATGATCGATACATGGCTAGGACAGAGCATATGACAATAATAAAGAAAAACAGCTTGCTGCCACAATACTGGATTGGGGCCGAAATCAGAATTCTCGAAGAGGACGCCGGAGTAGAGGAGGTCAGGGCAAAAGATGGTGAGCTTGTGGAGGGAGGACCAGCCACCGGGAGGCTCGGAGGAGGCGGTGGAGACAAGATCGAAGACGACGGAGCAAGGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.53

Weight (kDa)

4.51

Isoelectric Point (pI)

40.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 255
AcsI RAATTY 1 cut(s) 162
AcyI GRCGYC 1 cut(s) 177
AfiI CCNNNNNNNGG 2 cut(s) 236, 240
AluBI AGCT 2 cut(s) 126, 214
AluI AGCT 2 cut(s) 126, 214
Alw26I GTCTC 1 cut(s) 255
AoxI GGCC 2 cut(s) 21, 150
ApeKI GCWGC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 162
AspS9I GGNCC 2 cut(s) 150, 227
AsuC2I CCSGG 1 cut(s) 238
AsuHPI GGTGA 2 cut(s) 77, 221
AvaII GGWCC 1 cut(s) 227
BbsI GAAGAC 1 cut(s) 279
BbvI GCAGC 1 cut(s) 117
BccI CCATC 2 cut(s) 65, 200
BcnI CCSGG 1 cut(s) 238
BcoDI GTCTC 1 cut(s) 255
BfaI CTAG 1 cut(s) 90
BisI GCNGC 1 cut(s) 131
BlsI GCNGC 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 238
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 2 cut(s) 150, 227
BmiI GGNNCC 1 cut(s) 151
BmrFI CCNGG 1 cut(s) 238
BpiI GAAGAC 1 cut(s) 279
BpuMI CCSGG 1 cut(s) 238
Bsa29I ATCGAT 1 cut(s) 79
BsaBI GATNNNNATC 1 cut(s) 75
BsaHI GRCGYC 1 cut(s) 177
Bsc4I CCNNNNNNNGG 2 cut(s) 236, 240
Bse1I ACTGG 1 cut(s) 146
Bse8I GATNNNNATC 1 cut(s) 75
BseCI ATCGAT 1 cut(s) 79
BseGI GGATG 1 cut(s) 33
BseJI GATNNNNATC 1 cut(s) 75
BseLI CCNNNNNNNGG 2 cut(s) 236, 240
BseNI ACTGG 1 cut(s) 146
BseRI GAGGAG 2 cut(s) 203, 264
BseXI GCAGC 1 cut(s) 117
BshFI GGCC 2 cut(s) 23, 152
BshVI ATCGAT 1 cut(s) 79
BsiSI CCGG 2 cut(s) 180, 237
BslI CCNNNNNNNGG 2 cut(s) 236, 240
BsmAI GTCTC 1 cut(s) 255
BsnI GGCC 2 cut(s) 23, 152
Bsp143I GATC 2 cut(s) 76, 267
BspACI CCGC 1 cut(s) 255
BspANI GGCC 2 cut(s) 23, 152
BspDI ATCGAT 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 151
BsrI ACTGG 1 cut(s) 146
BssMI GATC 2 cut(s) 76, 267
BssNI GRCGYC 1 cut(s) 177
Bst4CI ACNGT 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 165
BstACI GRCGYC 1 cut(s) 177
BstC8I GCNNGC 1 cut(s) 128
BstF5I GGATG 1 cut(s) 33
BstKTI GATC 2 cut(s) 79, 270
BstMAI GTCTC 1 cut(s) 255
BstMBI GATC 2 cut(s) 76, 267
BstSCI CCNGG 1 cut(s) 236
BstV1I GCAGC 1 cut(s) 117
BstV2I GAAGAC 1 cut(s) 279
BstXI CCANNNNNNTGG 2 cut(s) 44, 141
Bsu15I ATCGAT 1 cut(s) 79
BsuRI GGCC 2 cut(s) 23, 152
BsuTUI ATCGAT 1 cut(s) 79
BtsCI GGATG 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 128
Cfr13I GGNCC 2 cut(s) 150, 227
ClaI ATCGAT 1 cut(s) 79
CseI GACGC 1 cut(s) 185
CviAII CATG 1 cut(s) 85
CviJI RGCY 7 cut(s) 23, 89, 126, 152, 214, 233, 244
CviKI_1 RGCY 7 cut(s) 23, 89, 126, 152, 214, 233, 244
DpnI GATC 2 cut(s) 78, 269
DpnII GATC 2 cut(s) 76, 267
Eam1104I CTCTTC 1 cut(s) 165
EarI CTCTTC 1 cut(s) 165
Eco147I AGGCCT 1 cut(s) 23
Eco47I GGWCC 1 cut(s) 227
EcoRI GAATTC 1 cut(s) 162
FaeI CATG 1 cut(s) 88
FaiI YATR 3 cut(s) 86, 102, 104
FatI CATG 1 cut(s) 84
FauNDI CATATG 1 cut(s) 102
Fnu4HI GCNGC 1 cut(s) 131
FokI GGATG 1 cut(s) 20
Fsp4HI GCNGC 1 cut(s) 131
FspBI CTAG 1 cut(s) 90
GluI GCNGC 1 cut(s) 131
HaeIII GGCC 2 cut(s) 23, 152
HapII CCGG 2 cut(s) 180, 237
HgaI GACGC 1 cut(s) 185
Hin1I GRCGYC 1 cut(s) 177
Hin1II CATG 1 cut(s) 88
HpaII CCGG 2 cut(s) 180, 237
HphI GGTGA 2 cut(s) 77, 221
Hpy188I TCNGA 2 cut(s) 161, 248
Hpy188III TCNNGA 1 cut(s) 167
Hpy99I CGWCG 1 cut(s) 281
HpyAV CCTTC 1 cut(s) 34
HpyCH4III ACNGT 1 cut(s) 16
Hsp92I GRCGYC 1 cut(s) 177
Hsp92II CATG 1 cut(s) 88
Kzo9I GATC 2 cut(s) 76, 267
LmnI GCTCC 1 cut(s) 281
LpnPI CCDG 5 cut(s) 127, 181, 193, 243, 250
Lsp1109I GCAGC 1 cut(s) 117
MaeI CTAG 1 cut(s) 90
MaeIII GTNAC 1 cut(s) 8
MalI GATC 2 cut(s) 78, 269
MboI GATC 2 cut(s) 76, 267
MboII GAAGA 3 cut(s) 80, 182, 284
MluCI AATT 1 cut(s) 162
MmeI TCCRAC 1 cut(s) 61
MnlI CCTC 9 cut(s) 13, 166, 181, 184, 214, 218, 234, 242, 245
MspI CCGG 2 cut(s) 180, 237
MspR9I CCNGG 1 cut(s) 238
NciI CCSGG 1 cut(s) 238
NdeI CATATG 1 cut(s) 102
NdeII GATC 2 cut(s) 76, 267
NlaIII CATG 1 cut(s) 88
NlaIV GGNNCC 1 cut(s) 151
PceI AGGCCT 1 cut(s) 23
PkrI GCNGC 1 cut(s) 132
PspN4I GGNNCC 1 cut(s) 151
PspPI GGNCC 2 cut(s) 150, 227
SatI GCNGC 1 cut(s) 131
Sau3AI GATC 2 cut(s) 76, 267
Sau96I GGNCC 2 cut(s) 150, 227
ScrFI CCNGG 1 cut(s) 238
SetI ASST 4 cut(s) 128, 195, 216, 290
SinI GGWCC 1 cut(s) 227
Sse9I AATT 1 cut(s) 162
SseBI AGGCCT 1 cut(s) 23
SsiI CCGC 1 cut(s) 255
SspMI CTAG 1 cut(s) 90
StuI AGGCCT 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 236
TaaI ACNGT 1 cut(s) 16
TaqI TCGA 3 cut(s) 79, 168, 270
TasI AATT 1 cut(s) 162
TseI GCWGC 1 cut(s) 130
TspGWI ACGGA 1 cut(s) 294
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 1 cut(s) 162
XcmI CCANNNNNNNNNTGG 1 cut(s) 44
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.