Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000459.1

Orthogroup ID

OG0009769

Physical Location & Seq

Genomic Coordinates Reverse (-)

107446 .. 109494

Gene Structure 2049 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000459.1_g000025.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 954 bp

atgccggagattcagttgggttctcacaccgtaaggtctcatggagttcaagtggcaaggtttcatatgcatgattggcttatgctggtggttcttgcggccatatatcttggtctgaacttgatagagccttttcaccgctttgttggagaggatatgatgacagacctgaaatacccattgaaaggcaatacagttcccttctggggtgttccaataattgcaatactgttaccgcttgccatcattgttgtctactacttcatcagaagggatgtctatgatctgcaccacgccattttaggccttctgttttctgtctttataaccgctgttttaactgaagcaatcaaagatggtgttggacgacctcgtccagactttttttggcgttgtttccctgatggaaaaggggtgtttgatcctgtcacaaagaatgtcatgtgtactggagagaagagtgtcattaaggaaggacacaaaagcttcccaagcgggcatgcttcagggtccttcgcaggtcttactttcattgcatggtacttgtcagggaaagtgagggtgtttgatcgcaaggggcatgttgcaaaactctgtattgtcttttctccattacttcttgcagcactggtagcagtttctcgagttgatgactactggcatcactggcaagatgtttttgctggaggtcttctaggagccattgtttcttcattttgttacttgcaattctttccaccaccatatgatactgatggttggggacctcatgcgtacttccagatgctggcagactctggaaatgctcagccaccgtccactaacgcaagtaatcttaatgtgcagcaagcagaactggagagtatatatatccatcatgatcaggttgttgaagcatcacaaaccagtagtggagacacaaaccccatgctaaatgatgggagaatacactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0003993 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0008195 GO:0009987 GO:0016020 GO:0016021 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0031224 GO:0031226 GO:0042578 GO:0044237 GO:0044425 GO:0044459 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00561 ko00564 ko01110 map00561 map00564 map01110

Pfam Domains

Protein Families

PAP2

Protein Analysis

317

Amino Acids

35.35

Weight (kDa)

6.33

Isoelectric Point (pI)

33.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009769)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g26640 FvH4_4g26640 FvH4_4g26640 FvH4_4g26640 FvH4_4g26640
malus_domestica	MD13G1034700.v1.1 MD16G1036400.v1.1
prunus_persica	Prupe.1G317500_v2.0.a1
pyrus_communis	pycom13g03030 pycom16g03150
rosa_chinensis	RchiOBHm_Chr4g0434321 RchiOBHm_Chr4g0434331
rosa_laevigata	RLG00000006682
rosa_multiflora	Rmu_sc0000459.1_g000025 Rmu_sc0000459.1_g000027
rosa_roxburghii	Rroxscaffold_5G00375680 Rroxscaffold_5G00375690
rosa_rugosa	Rorug04G0275900.1
rosa_samantha	Rh4AG331200
rosa_wichuraiana	Rw4G028710 Rw4G028720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	326
AasI	GACNNNNNNGTC	1 cut(s)	372
Acc36I	ACCTGC	1 cut(s)	509
AccB7I	CCANNNNNTGG	1 cut(s)	787
AccI	GTMKAC	1 cut(s)	255
AciI	CCGC	5 cut(s)	98, 139, 236, 330, 495
AclWI	GGATC	1 cut(s)	416
AcoI	YGGCCR	1 cut(s)	99
AcuI	CTGAAG	2 cut(s)	363, 489
AfaI	GTAC	3 cut(s)	448, 542, 776
AfiI	CCNNNNNNNGG	3 cut(s)	185, 206, 787
AgsI	TTSAA	3 cut(s)	50, 184, 893
AluBI	AGCT	1 cut(s)	486
AluI	AGCT	1 cut(s)	486
Alw26I	GTCTC	2 cut(s)	42, 909
AlwI	GGATC	1 cut(s)	416
AlwNI	CAGNNNCTG	2 cut(s)	787, 797
Ama87I	CYCGRG	1 cut(s)	642
AoxI	GGCC	2 cut(s)	99, 304
ApeKI	GCWGC	2 cut(s)	623, 844
AspS9I	GGNCC	2 cut(s)	510, 764
AsuHPI	GGTGA	1 cut(s)	128
AvaI	CYCGRG	1 cut(s)	642
AvaII	GGWCC	2 cut(s)	510, 764
BbsI	GAAGAC	1 cut(s)	683
BbvI	GCAGC	2 cut(s)	635, 856
BccI	CCATC	6 cut(s)	251, 350, 398, 749, 882, 932
BclI	TGATCA	1 cut(s)	880
BcoDI	GTCTC	2 cut(s)	42, 909
BfaI	CTAG	2 cut(s)	695, 952
BfuAI	ACCTGC	1 cut(s)	509
BisI	GCNGC	3 cut(s)	99, 624, 845
BlpI	GCTNAGC	1 cut(s)	807
BlsI	GCNGC	3 cut(s)	100, 625, 846
Bme18I	GGWCC	2 cut(s)	510, 764
BmeT110I	CYCGRG	1 cut(s)	642
BmgT120I	GGNCC	2 cut(s)	510, 764
BmiI	GGNNCC	3 cut(s)	511, 700, 765
BmsI	GCATC	3 cut(s)	670, 774, 905
BpiI	GAAGAC	1 cut(s)	683
BpmI	CTGGAG	3 cut(s)	471, 705, 878
Bpu1102I	GCTNAGC	1 cut(s)	807
BsaI	GGTCTC	1 cut(s)	42
BsaXI	ACNNNNNCTCC	5 cut(s)	29, 36, 66, 690, 720
Bsc4I	CCNNNNNNNGG	3 cut(s)	185, 206, 787
Bse1I	ACTGG	6 cut(s)	454, 633, 662, 671, 861, 906
Bse3DI	GCAATG	1 cut(s)	531
BseGI	GGATG	1 cut(s)	280
BseLI	CCNNNNNNNGG	3 cut(s)	185, 206, 787
BseMI	GCAATG	1 cut(s)	531
BseMII	CTCAG	1 cut(s)	821
BseNI	ACTGG	6 cut(s)	454, 633, 662, 671, 861, 906
BseXI	GCAGC	2 cut(s)	635, 856
BsgI	GTGCAG	2 cut(s)	272, 863
BshFI	GGCC	2 cut(s)	101, 306
BsiHKCI	CYCGRG	1 cut(s)	642
BsiSI	CCGG	1 cut(s)	5
BslFI	GGGAC	1 cut(s)	777
BslI	CCNNNNNNNGG	3 cut(s)	185, 206, 787
BsmAI	GTCTC	2 cut(s)	42, 909
BsmFI	GGGAC	1 cut(s)	777
BsnI	GGCC	2 cut(s)	101, 306
Bso31I	GGTCTC	1 cut(s)	42
BsoBI	CYCGRG	1 cut(s)	642
Bsp143I	GATC	4 cut(s)	283, 421, 568, 880
Bsp1720I	GCTNAGC	1 cut(s)	807
BspACI	CCGC	5 cut(s)	98, 139, 236, 330, 495
BspANI	GGCC	2 cut(s)	101, 306
BspCNI	CTCAG	1 cut(s)	820
BspHI	TCATGA	1 cut(s)	877
BspLI	GGNNCC	3 cut(s)	511, 700, 765
BspMI	ACCTGC	1 cut(s)	509
BspPI	GGATC	1 cut(s)	416
BspTNI	GGTCTC	1 cut(s)	42
BsrDI	GCAATG	1 cut(s)	531
BsrI	ACTGG	6 cut(s)	454, 633, 662, 671, 861, 906
BssMI	GATC	4 cut(s)	283, 421, 568, 880
Bst4CI	ACNGT	4 cut(s)	31, 196, 231, 816
Bst6I	CTCTTC	1 cut(s)	452
BstC8I	GCNNGC	5 cut(s)	240, 497, 501, 789, 849
BstDEI	CTNAG	1 cut(s)	807
BstF5I	GGATG	1 cut(s)	280
BstKTI	GATC	4 cut(s)	286, 424, 571, 883
BstMAI	GTCTC	2 cut(s)	42, 909
BstMBI	GATC	4 cut(s)	283, 421, 568, 880
BstMWI	GCNNNNNNNGC	4 cut(s)	76, 492, 632, 667
BstNSI	RCATGY	2 cut(s)	503, 584
BstV1I	GCAGC	2 cut(s)	635, 856
BstV2I	GAAGAC	1 cut(s)	683
BsuRI	GGCC	2 cut(s)	101, 306
BtsCI	GGATG	1 cut(s)	280
BtsIMutI	CAGTG	2 cut(s)	626, 664
BveI	ACCTGC	1 cut(s)	509
Cac8I	GCNNGC	5 cut(s)	240, 497, 501, 789, 849
CaiI	CAGNNNCTG	2 cut(s)	787, 797
CciI	TCATGA	1 cut(s)	877
Cfr13I	GGNCC	2 cut(s)	510, 764
Csp6I	GTAC	3 cut(s)	447, 541, 775
CviAII	CATG	9 cut(s)	41, 71, 442, 500, 537, 581, 770, 878, 928
CviJI	RGCY	7 cut(s)	79, 101, 130, 306, 486, 701, 811
CviKI_1	RGCY	7 cut(s)	79, 101, 130, 306, 486, 701, 811
CviQI	GTAC	3 cut(s)	447, 541, 775
DdeI	CTNAG	1 cut(s)	807
DpnI	GATC	4 cut(s)	285, 423, 570, 882
DpnII	GATC	4 cut(s)	283, 421, 568, 880
DrdI	GACNNNNNNGTC	1 cut(s)	372
DseDI	GACNNNNNNGTC	1 cut(s)	372
EaeI	YGGCCR	1 cut(s)	99
Eam1104I	CTCTTC	1 cut(s)	452
EarI	CTCTTC	1 cut(s)	452
Eco147I	AGGCCT	1 cut(s)	306
Eco31I	GGTCTC	1 cut(s)	42
Eco47I	GGWCC	2 cut(s)	510, 764
Eco57I	CTGAAG	2 cut(s)	363, 489
Eco88I	CYCGRG	1 cut(s)	642
EcoO109I	RGGNCCY	2 cut(s)	510, 764
EcoT22I	ATGCAT	1 cut(s)	72
FaeI	CATG	9 cut(s)	44, 74, 445, 503, 540, 584, 773, 881, 931
FaqI	GGGAC	1 cut(s)	777
FatI	CATG	9 cut(s)	40, 70, 441, 499, 536, 580, 769, 877, 927
FauI	CCCGC	1 cut(s)	488
FauNDI	CATATG	2 cut(s)	66, 745
FbaI	TGATCA	1 cut(s)	880
FblI	GTMKAC	1 cut(s)	255
Fnu4HI	GCNGC	3 cut(s)	99, 624, 845
FokI	GGATG	1 cut(s)	287
Fsp4HI	GCNGC	3 cut(s)	99, 624, 845
FspBI	CTAG	2 cut(s)	695, 952
GluI	GCNGC	3 cut(s)	99, 624, 845
GsuI	CTGGAG	3 cut(s)	471, 705, 878
HaeIII	GGCC	2 cut(s)	101, 306
HapII	CCGG	1 cut(s)	5
Hin1II	CATG	9 cut(s)	44, 74, 445, 503, 540, 584, 773, 881, 931
HindIII	AAGCTT	1 cut(s)	484
HinfI	GANTC	2 cut(s)	10, 794
HpaII	CCGG	1 cut(s)	5
HphI	GGTGA	1 cut(s)	128
Hpy166II	GTNNAC	3 cut(s)	256, 447, 819
Hpy188I	TCNGA	2 cut(s)	117, 269
Hpy188III	TCNNGA	5 cut(s)	377, 642, 781, 798, 878
Hpy8I	GTNNAC	3 cut(s)	256, 447, 819
HpyAV	CCTTC	5 cut(s)	211, 264, 317, 467, 523
HpyCH4III	ACNGT	4 cut(s)	31, 196, 231, 816
HpyCH4V	TGCA	8 cut(s)	70, 224, 289, 536, 587, 623, 727, 844
HpyF10VI	GCNNNNNNNGC	4 cut(s)	76, 492, 632, 667
HpyF3I	CTNAG	1 cut(s)	807
Hsp92II	CATG	9 cut(s)	44, 74, 445, 503, 540, 584, 773, 881, 931
Ksp22I	TGATCA	1 cut(s)	880
Kzo9I	GATC	4 cut(s)	283, 421, 568, 880
LmnI	GCTCC	1 cut(s)	698
Lsp1109I	GCAGC	2 cut(s)	635, 856
LweI	GCATC	3 cut(s)	670, 774, 905
MaeI	CTAG	2 cut(s)	695, 952
MaeIII	GTNAC	3 cut(s)	231, 427, 719
MalI	GATC	4 cut(s)	285, 423, 570, 882
MboI	GATC	4 cut(s)	283, 421, 568, 880
MboII	GAAGA	3 cut(s)	469, 683, 702
MluCI	AATT	2 cut(s)	219, 728
MlyI	GAGTC	1 cut(s)	788
MmeI	TCCRAC	2 cut(s)	127, 343
MnlI	CCTC	5 cut(s)	145, 381, 552, 680, 777
Mph1103I	ATGCAT	1 cut(s)	72
MseI	TTAA	3 cut(s)	338, 468, 837
MslI	CAYNNNNRTG	1 cut(s)	69
MspA1I	CMGCKG	1 cut(s)	332
MspI	CCGG	1 cut(s)	5
MwoI	GCNNNNNNNGC	4 cut(s)	76, 492, 632, 667
NdeI	CATATG	2 cut(s)	66, 745
NdeII	GATC	4 cut(s)	283, 421, 568, 880
NlaIII	CATG	9 cut(s)	44, 74, 445, 503, 540, 584, 773, 881, 931
NlaIV	GGNNCC	3 cut(s)	511, 700, 765
NmuCI	GTSAC	1 cut(s)	427
NsiI	ATGCAT	1 cut(s)	72
NspI	RCATGY	2 cut(s)	503, 584
PaeI	GCATGC	1 cut(s)	503
PaeR7I	CTCGAG	1 cut(s)	642
PagI	TCATGA	1 cut(s)	877
PceI	AGGCCT	1 cut(s)	306
PfeI	GAWTC	1 cut(s)	10
PflFI	GACNNNGTC	1 cut(s)	372
PflMI	CCANNNNNTGG	1 cut(s)	787
PkrI	GCNGC	3 cut(s)	100, 625, 846
PleI	GAGTC	1 cut(s)	788
PpsI	GAGTC	1 cut(s)	788
PpuMI	RGGWCCY	2 cut(s)	510, 764
PsiI	TTATAA	1 cut(s)	326
Psp5II	RGGWCCY	2 cut(s)	510, 764
PspN4I	GGNNCC	3 cut(s)	511, 700, 765
PspPI	GGNCC	2 cut(s)	510, 764
PspPPI	RGGWCCY	2 cut(s)	510, 764
PstNI	CAGNNNCTG	2 cut(s)	787, 797
PsyI	GACNNNGTC	1 cut(s)	372
RsaI	GTAC	3 cut(s)	448, 542, 776
RsaNI	GTAC	3 cut(s)	447, 541, 775
RseI	CAYNNNNRTG	1 cut(s)	69
SaqAI	TTAA	3 cut(s)	338, 468, 837
SatI	GCNGC	3 cut(s)	99, 624, 845
Sau3AI	GATC	4 cut(s)	283, 421, 568, 880
Sau96I	GGNCC	2 cut(s)	510, 764
SchI	GAGTC	1 cut(s)	788
SetI	ASST	9 cut(s)	38, 62, 171, 373, 488, 523, 691, 769, 888
SfaNI	GCATC	3 cut(s)	670, 774, 905
Sfr274I	CTCGAG	1 cut(s)	642
SinI	GGWCC	2 cut(s)	510, 764
SlaI	CTCGAG	1 cut(s)	642
SmiMI	CAYNNNNRTG	1 cut(s)	69
SmlI	CTYRAG	1 cut(s)	642
SmoI	CTYRAG	1 cut(s)	642
SphI	GCATGC	1 cut(s)	503
Sse9I	AATT	2 cut(s)	219, 728
SseBI	AGGCCT	1 cut(s)	306
SsiI	CCGC	5 cut(s)	98, 139, 236, 330, 495
SspMI	CTAG	2 cut(s)	695, 952
StuI	AGGCCT	1 cut(s)	306
TaaI	ACNGT	4 cut(s)	31, 196, 231, 816
TaqI	TCGA	1 cut(s)	643
TasI	AATT	2 cut(s)	219, 728
TatI	WGTACW	1 cut(s)	446
TauI	GCSGC	1 cut(s)	101
TfiI	GAWTC	1 cut(s)	10
Tru1I	TTAA	3 cut(s)	338, 468, 837
Tru9I	TTAA	3 cut(s)	338, 468, 837
TscAI	CASTG	2 cut(s)	633, 671
TseFI	GTSAC	1 cut(s)	427
TseI	GCWGC	2 cut(s)	623, 844
Tsp45I	GTSAC	1 cut(s)	427
TspDTI	ATGAA	4 cut(s)	53, 253, 520, 702
TspRI	CASTG	2 cut(s)	633, 671
Tth111I	GACNNNGTC	1 cut(s)	372
Van91I	CCANNNNNTGG	1 cut(s)	787
VpaK11BI	GGWCC	2 cut(s)	510, 764
XceI	RCATGY	2 cut(s)	503, 584
XcmI	CCANNNNNNNNNTGG	1 cut(s)	384
XhoI	CTCGAG	1 cut(s)	642
XmiI	GTMKAC	1 cut(s)	255
XspI	CTAG	2 cut(s)	695, 952
Zsp2I	ATGCAT	1 cut(s)	72

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.