Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000673.1

Orthogroup ID

OG0013727

Physical Location & Seq

Genomic Coordinates Forward (+)

41249 .. 41572

Gene Structure 324 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000673.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 324 bp

atgggtcactgtgccttggcccaaagacgcaatgctagtgaatgtgggagacctactagagattatgagcaatggatgtttagaagtccatggcatagggttgttacccaaatggatgtagagaggttttcagtggctttattctataatccaagtcctcgaactcagattgagcagattggtaattgttcattggcaaatgatgatgatgttgaggggtataagaaggtggttgtgggtgactatttgcaacatttttataggattagtcctactgtgaagaaacaagctatcagctttgccaaaagagtaccaagatcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

107

Amino Acids

12.47

Weight (kDa)

9.37

Isoelectric Point (pI)

63.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013727)

Species	Orthologous Gene IDs
malus_domestica	MD10G1107900.v1.1
pyrus_communis	pycom10g09320
rosa_chinensis	RchiOBHm_Chr6g0252601
rosa_laevigata	RLG00000015082 RLG00000015086
rosa_multiflora	Rmu_sc0000673.1_g000006 Rmu_sc0002016.1_g000034 Rmu_sc0002016.1_g000042 Rmu_sc0023610.1_g000001
rosa_roxburghii	Rroxscaffold_7G00212530 Rroxscaffold_7G00212570
rosa_rugosa	Rorug05G0537200
rosa_samantha	Rh6AG053600 Rh6BG047400 Rh6CG045900 Rh6DG041600
rosa_wichuraiana	Rw6G004810 Rw6G004820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	312
AluBI	AGCT	2 cut(s)	290, 297
AluI	AGCT	2 cut(s)	290, 297
Alw26I	GTCTC	1 cut(s)	43
AoxI	GGCC	1 cut(s)	18
AspS9I	GGNCC	1 cut(s)	19
AsuHPI	GGTGA	1 cut(s)	251
BcoDI	GTCTC	1 cut(s)	43
BfaI	CTAG	2 cut(s)	36, 57
BmgT120I	GGNCC	1 cut(s)	19
BsaI	GGTCTC	1 cut(s)	43
BsaJI	CCNNGG	2 cut(s)	15, 89
Bse3DI	GCAATG	2 cut(s)	37, 77
BseDI	CCNNGG	2 cut(s)	15, 89
BseGI	GGATG	2 cut(s)	81, 121
BseMI	GCAATG	2 cut(s)	37, 77
BseMII	CTCAG	1 cut(s)	179
BshFI	GGCC	1 cut(s)	20
BsmAI	GTCTC	1 cut(s)	43
BsnI	GGCC	1 cut(s)	20
Bso31I	GGTCTC	1 cut(s)	43
Bsp143I	GATC	1 cut(s)	317
Bsp19I	CCATGG	1 cut(s)	89
BspANI	GGCC	1 cut(s)	20
BspCNI	CTCAG	1 cut(s)	178
BspTNI	GGTCTC	1 cut(s)	43
BsrDI	GCAATG	2 cut(s)	37, 77
BssECI	CCNNGG	2 cut(s)	15, 89
BssMI	GATC	1 cut(s)	317
BssT1I	CCWWGG	2 cut(s)	15, 89
Bst4CI	ACNGT	2 cut(s)	11, 277
BstDEI	CTNAG	1 cut(s)	165
BstDSI	CCRYGG	1 cut(s)	89
BstF5I	GGATG	2 cut(s)	81, 121
BstKTI	GATC	1 cut(s)	320
BstMAI	GTCTC	1 cut(s)	43
BstMBI	GATC	1 cut(s)	317
BsuRI	GGCC	1 cut(s)	20
BtgI	CCRYGG	1 cut(s)	89
BtsCI	GGATG	2 cut(s)	81, 121
BtsIMutI	CAGTG	2 cut(s)	7, 138
Cfr13I	GGNCC	1 cut(s)	19
CseI	GACGC	1 cut(s)	36
Csp6I	GTAC	1 cut(s)	311
CviAII	CATG	1 cut(s)	90
CviJI	RGCY	4 cut(s)	20, 137, 290, 297
CviKI_1	RGCY	4 cut(s)	20, 137, 290, 297
CviQI	GTAC	1 cut(s)	311
DdeI	CTNAG	1 cut(s)	165
DpnI	GATC	1 cut(s)	319
DpnII	GATC	1 cut(s)	317
Eco130I	CCWWGG	2 cut(s)	15, 89
Eco31I	GGTCTC	1 cut(s)	43
EcoT14I	CCWWGG	2 cut(s)	15, 89
ErhI	CCWWGG	2 cut(s)	15, 89
FaeI	CATG	1 cut(s)	93
FaiI	YATR	7 cut(s)	66, 91, 96, 147, 222, 261, 322
FatI	CATG	1 cut(s)	89
FokI	GGATG	2 cut(s)	88, 128
FspBI	CTAG	2 cut(s)	36, 57
HaeIII	GGCC	1 cut(s)	20
HgaI	GACGC	1 cut(s)	36
Hin1II	CATG	1 cut(s)	93
HphI	GGTGA	1 cut(s)	251
Hpy188I	TCNGA	1 cut(s)	168
HpyAV	CCTTC	1 cut(s)	220
HpyCH4III	ACNGT	2 cut(s)	11, 277
HpyCH4V	TGCA	1 cut(s)	250
HpyF3I	CTNAG	1 cut(s)	165
Hsp92II	CATG	1 cut(s)	93
Kzo9I	GATC	1 cut(s)	317
MaeI	CTAG	2 cut(s)	36, 57
MaeIII	GTNAC	3 cut(s)	5, 103, 239
MalI	GATC	1 cut(s)	319
MboI	GATC	1 cut(s)	317
MboII	GAAGA	1 cut(s)	292
MluCI	AATT	1 cut(s)	184
MnlI	CCTC	3 cut(s)	117, 168, 208
NcoI	CCATGG	1 cut(s)	89
NdeII	GATC	1 cut(s)	317
NlaIII	CATG	1 cut(s)	93
NmuCI	GTSAC	2 cut(s)	5, 239
PspPI	GGNCC	1 cut(s)	19
RsaI	GTAC	1 cut(s)	312
RsaNI	GTAC	1 cut(s)	311
Sau3AI	GATC	1 cut(s)	317
Sau96I	GGNCC	1 cut(s)	19
SetI	ASST	5 cut(s)	55, 128, 231, 292, 299
SgeI	CNNG	7 cut(s)	28, 48, 69, 102, 165, 171, 299
Sse9I	AATT	1 cut(s)	184
SspMI	CTAG	2 cut(s)	36, 57
StyI	CCWWGG	2 cut(s)	15, 89
TaaI	ACNGT	2 cut(s)	11, 277
TaqI	TCGA	1 cut(s)	160
TasI	AATT	1 cut(s)	184
TscAI	CASTG	2 cut(s)	14, 138
TseFI	GTSAC	2 cut(s)	5, 239
Tsp45I	GTSAC	2 cut(s)	5, 239
TspDTI	ATGAA	1 cut(s)	180
TspRI	CASTG	2 cut(s)	14, 138
XspI	CTAG	2 cut(s)	36, 57

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.