Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0023610.1

Orthogroup ID

OG0013727

Physical Location & Seq

Genomic Coordinates Forward (+)

139 .. 777

Gene Structure 639 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0023610.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 639 bp

atgtataaccattctgttcacaaagatttaattggtttgagcaggcatgctatagagcaatatgttgcagaagcaagaaacatcttcaatgacattcttgaagcccttgctgaagccttatcactagaaagacatgtattcctccaaaactttaacccctatgaaactgtgatcaatttgagagtgaactactacccaccatgcccgaggcctgaccaagcccttggtctaactccacacactgatgccagtgccctcactctccttcttcaattcgaagccagcggagggctccaagtgttgaaggacatggaatgggtcaccgtgccttggccaaaagacacaatgctagtgaatgtgggagacctactagagattatgagcaatgggatatttagaagtccatggcatagggttgttacccaaatggatgtagagaggttttcagtggctttattctataatccaagtcctcgaactcagattgagccgattgggaattgttcattggcaaatgatgatgttgttgaggggtataagaaggtggttgtgggtgactatttgcaacatttttataggattagtcctaccgtgaagaaacaagctatcagctttgccaaaagagtacccagatcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

212

Amino Acids

24.16

Weight (kDa)

6.15

Isoelectric Point (pI)

45.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013727)

Species	Orthologous Gene IDs
malus_domestica	MD10G1107900.v1.1
pyrus_communis	pycom10g09320
rosa_chinensis	RchiOBHm_Chr6g0252601
rosa_laevigata	RLG00000015082 RLG00000015086
rosa_multiflora	Rmu_sc0000673.1_g000006 Rmu_sc0002016.1_g000034 Rmu_sc0002016.1_g000042 Rmu_sc0023610.1_g000001
rosa_roxburghii	Rroxscaffold_7G00212530 Rroxscaffold_7G00212570
rosa_rugosa	Rorug05G0537200
rosa_samantha	Rh6AG053600 Rh6BG047400 Rh6CG045900 Rh6DG041600
rosa_wichuraiana	Rw6G004810 Rw6G004820

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	285
AcoI	YGGCCR	1 cut(s)	332
AcuI	CTGAAG	1 cut(s)	132
AfaI	GTAC	1 cut(s)	627
AfiI	CCNNNNNNNGG	2 cut(s)	288, 330
AflIII	ACRYGT	1 cut(s)	133
AgsI	TTSAA	4 cut(s)	88, 101, 272, 304
AjuI	GAANNNNNNNTTGG	2 cut(s)	491, 523
AluBI	AGCT	2 cut(s)	605, 612
AluI	AGCT	2 cut(s)	605, 612
Alw26I	GTCTC	1 cut(s)	357
Ama87I	CYCGRG	1 cut(s)	205
AoxI	GGCC	2 cut(s)	209, 332
AsuHPI	GGTGA	2 cut(s)	313, 566
AsuII	TTCGAA	1 cut(s)	276
AvaI	CYCGRG	1 cut(s)	205
BaeGI	GKGCMC	1 cut(s)	256
BalI	TGGCCA	1 cut(s)	334
BanII	GRGCYC	1 cut(s)	294
BclI	TGATCA	1 cut(s)	171
BcoDI	GTCTC	1 cut(s)	357
BfaI	CTAG	3 cut(s)	125, 350, 371
BfmI	CTRYAG	1 cut(s)	51
BmeT110I	CYCGRG	1 cut(s)	205
BmiI	GGNNCC	1 cut(s)	293
BmsI	GCATC	1 cut(s)	235
Bpu14I	TTCGAA	1 cut(s)	276
BsaI	GGTCTC	1 cut(s)	357
BsaJI	CCNNGG	4 cut(s)	206, 223, 329, 404
Bsc4I	CCNNNNNNNGG	2 cut(s)	288, 330
Bse1I	ACTGG	1 cut(s)	249
Bse3DI	GCAATG	1 cut(s)	391
BseDI	CCNNGG	4 cut(s)	206, 223, 329, 404
BseGI	GGATG	1 cut(s)	436
BseLI	CCNNNNNNNGG	2 cut(s)	288, 330
BseMI	GCAATG	1 cut(s)	391
BseMII	CTCAG	1 cut(s)	494
BseNI	ACTGG	1 cut(s)	249
BseSI	GKGCMC	1 cut(s)	256
BshFI	GGCC	2 cut(s)	211, 334
BsiHKCI	CYCGRG	1 cut(s)	205
BslI	CCNNNNNNNGG	2 cut(s)	288, 330
BsmAI	GTCTC	1 cut(s)	357
BsnI	GGCC	2 cut(s)	211, 334
Bso31I	GGTCTC	1 cut(s)	357
BsoBI	CYCGRG	1 cut(s)	205
Bsp119I	TTCGAA	1 cut(s)	276
Bsp1286I	GDGCHC	2 cut(s)	256, 294
Bsp143I	GATC	2 cut(s)	171, 632
Bsp19I	CCATGG	1 cut(s)	404
BspACI	CCGC	1 cut(s)	285
BspANI	GGCC	2 cut(s)	211, 334
BspCNI	CTCAG	1 cut(s)	493
BspLI	GGNNCC	1 cut(s)	293
BspT104I	TTCGAA	1 cut(s)	276
BspTNI	GGTCTC	1 cut(s)	357
BsrDI	GCAATG	1 cut(s)	391
BsrI	ACTGG	1 cut(s)	249
BssECI	CCNNGG	4 cut(s)	206, 223, 329, 404
BssMI	GATC	2 cut(s)	171, 632
BssT1I	CCWWGG	3 cut(s)	223, 329, 404
Bst4CI	ACNGT	3 cut(s)	169, 325, 592
BstBI	TTCGAA	1 cut(s)	276
BstC8I	GCNNGC	3 cut(s)	44, 48, 283
BstDEI	CTNAG	1 cut(s)	480
BstDSI	CCRYGG	1 cut(s)	404
BstEII	GGTNACC	1 cut(s)	319
BstF5I	GGATG	1 cut(s)	436
BstKTI	GATC	2 cut(s)	174, 635
BstMAI	GTCTC	1 cut(s)	357
BstMBI	GATC	2 cut(s)	171, 632
BstNSI	RCATGY	2 cut(s)	50, 137
BstPI	GGTNACC	1 cut(s)	319
BstSFI	CTRYAG	1 cut(s)	51
BstSLI	GKGCMC	1 cut(s)	256
BstXI	CCANNNNNNTGG	1 cut(s)	224
BsuRI	GGCC	2 cut(s)	211, 334
BtgI	CCRYGG	1 cut(s)	404
BtsCI	GGATG	1 cut(s)	436
BtsIMutI	CAGTG	3 cut(s)	240, 256, 453
Cac8I	GCNNGC	3 cut(s)	44, 48, 283
Csp6I	GTAC	1 cut(s)	626
CviAII	CATG	5 cut(s)	47, 134, 201, 310, 405
CviQI	GTAC	1 cut(s)	626
DdeI	CTNAG	1 cut(s)	480
DpnI	GATC	2 cut(s)	173, 634
DpnII	GATC	2 cut(s)	171, 632
EaeI	YGGCCR	1 cut(s)	332
Eco130I	CCWWGG	3 cut(s)	223, 329, 404
Eco147I	AGGCCT	1 cut(s)	211
Eco24I	GRGCYC	1 cut(s)	294
Eco31I	GGTCTC	1 cut(s)	357
Eco57I	CTGAAG	1 cut(s)	132
Eco88I	CYCGRG	1 cut(s)	205
Eco91I	GGTNACC	1 cut(s)	319
EcoO65I	GGTNACC	1 cut(s)	319
EcoT14I	CCWWGG	3 cut(s)	223, 329, 404
EcoT38I	GRGCYC	1 cut(s)	294
ErhI	CCWWGG	3 cut(s)	223, 329, 404
FaeI	CATG	5 cut(s)	50, 137, 204, 313, 408
FatI	CATG	5 cut(s)	46, 133, 200, 309, 404
FbaI	TGATCA	1 cut(s)	171
FokI	GGATG	1 cut(s)	443
FriOI	GRGCYC	1 cut(s)	294
FspBI	CTAG	3 cut(s)	125, 350, 371
HaeIII	GGCC	2 cut(s)	211, 334
Hin1II	CATG	5 cut(s)	50, 137, 204, 313, 408
HphI	GGTGA	2 cut(s)	313, 566
Hpy166II	GTNNAC	2 cut(s)	19, 187
Hpy188I	TCNGA	1 cut(s)	483
Hpy188III	TCNNGA	1 cut(s)	98
Hpy8I	GTNNAC	2 cut(s)	19, 187
HpyAV	CCTTC	3 cut(s)	275, 298, 535
HpyCH4III	ACNGT	3 cut(s)	169, 325, 592
HpyCH4V	TGCA	2 cut(s)	68, 565
HpyF3I	CTNAG	1 cut(s)	480
Hsp92II	CATG	5 cut(s)	50, 137, 204, 313, 408
Ksp22I	TGATCA	1 cut(s)	171
Kzo9I	GATC	2 cut(s)	171, 632
LmnI	GCTCC	1 cut(s)	297
LpnPI	CCDG	4 cut(s)	28, 225, 262, 295
LweI	GCATC	1 cut(s)	235
MaeI	CTAG	3 cut(s)	125, 350, 371
MaeIII	GTNAC	3 cut(s)	319, 418, 554
MalI	GATC	2 cut(s)	173, 634
MboI	GATC	2 cut(s)	171, 632
MboII	GAAGA	3 cut(s)	76, 260, 607
MhlI	GDGCHC	2 cut(s)	256, 294
MlsI	TGGCCA	1 cut(s)	334
MluCI	AATT	4 cut(s)	30, 175, 272, 499
MluNI	TGGCCA	1 cut(s)	334
MnlI	CCTC	7 cut(s)	152, 201, 266, 281, 432, 483, 523
Mox20I	TGGCCA	1 cut(s)	334
MscI	TGGCCA	1 cut(s)	334
MseI	TTAA	2 cut(s)	29, 153
MslI	CAYNNNNRTG	1 cut(s)	243
Msp20I	TGGCCA	1 cut(s)	334
MspA1I	CMGCKG	1 cut(s)	285
NcoI	CCATGG	1 cut(s)	404
NdeII	GATC	2 cut(s)	171, 632
NlaIII	CATG	5 cut(s)	50, 137, 204, 313, 408
NlaIV	GGNNCC	1 cut(s)	293
NmuCI	GTSAC	2 cut(s)	319, 554
NspI	RCATGY	2 cut(s)	50, 137
NspV	TTCGAA	1 cut(s)	276
PaeI	GCATGC	1 cut(s)	50
PceI	AGGCCT	1 cut(s)	211
PciI	ACATGT	1 cut(s)	133
PscI	ACATGT	1 cut(s)	133
PspEI	GGTNACC	1 cut(s)	319
PspN4I	GGNNCC	1 cut(s)	293
RsaI	GTAC	1 cut(s)	627
RsaNI	GTAC	1 cut(s)	626
RseI	CAYNNNNRTG	1 cut(s)	243
SaqAI	TTAA	2 cut(s)	29, 153
Sau3AI	GATC	2 cut(s)	171, 632
SduI	GDGCHC	2 cut(s)	256, 294
SetI	ASST	5 cut(s)	369, 443, 546, 607, 614
SfaNI	GCATC	1 cut(s)	235
SfcI	CTRYAG	1 cut(s)	51
SfuI	TTCGAA	1 cut(s)	276
SmiMI	CAYNNNNRTG	1 cut(s)	243
SphI	GCATGC	1 cut(s)	50
Sse9I	AATT	4 cut(s)	30, 175, 272, 499
SseBI	AGGCCT	1 cut(s)	211
SsiI	CCGC	1 cut(s)	285
SspMI	CTAG	3 cut(s)	125, 350, 371
StuI	AGGCCT	1 cut(s)	211
StyI	CCWWGG	3 cut(s)	223, 329, 404
TaaI	ACNGT	3 cut(s)	169, 325, 592
TaqI	TCGA	2 cut(s)	276, 475
TasI	AATT	4 cut(s)	30, 175, 272, 499
Tru1I	TTAA	2 cut(s)	29, 153
Tru9I	TTAA	2 cut(s)	29, 153
TscAI	CASTG	3 cut(s)	247, 256, 453
TseFI	GTSAC	2 cut(s)	319, 554
Tsp45I	GTSAC	2 cut(s)	319, 554
TspDTI	ATGAA	2 cut(s)	177, 495
TspRI	CASTG	3 cut(s)	247, 256, 453
XceI	RCATGY	2 cut(s)	50, 137
XspI	CTAG	3 cut(s)	125, 350, 371

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.