Rmu_sc0000674.1_g000028

Dehydration-responsive element-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000674.1
OG0008991
Physical Location & Seq
Forward (+)
144899 .. 147173
2275 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 768 bp
atgaaaaaaaatggatctttcagcccaaaggcttattgggttcatgggctctcttgcataagggacaaaatttcaaatgattgtgccaattttcggccccaattgcgagactcaaggctggggagtcacggagcagaacaaggtatctcattgtattccctgttcagtacaaatttggattgtatgaccaagttgaacaaattccatagtaaacaggatggatctaatcctgtggctgagactcttgcgaagtggaaagagcttaacgacaatctagaatcatccaatgatgggagtaaaccaactcgcaaagttcctgccaaggggtctaagaagggatgcatgaaaggtaagggaggacctgagaattctcgatgtaactacagaggtgttaggcagaggacatggggcaagtgggttgcagaaatccgctcaccaaataggggaagtaggctctggctaggtacctttccaactgcaattgaagctgctcttgcctacgatgaagctgcaagggccatgtacggttcctctgcccgtctcaactttccgaaggttacgatctccagttactcaacaaattcttcttgtagagcaactctatcggctccttcctgtgtagtgacttctgcaggttcagaatcatcaggtcactctgaggatttttcgcctcaggataaggtgaattctcattcccctcacgtagtgaacactgatgttatcgatctaaatcaaatggatctaaatcataccgaggaggatgaatga

Protein Analysis

255

Amino Acids

27.98

Weight (kDa)

9.03

Isoelectric Point (pI)

43.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AP2 PF00847 127 - 176 2.9e-15 AP2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008991)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G40340 AT2G40340 AT2G40340 AT2G40340 AT2G40340 AT2G40340 AT2G40350 AT2G40350
fragaria_vesca FvH4_6g43870
malus_domestica MD17G1089700.v1.1
prunus_persica Prupe.3G223300_v2.0.a1
pyrus_communis pycom17g08690
rosa_chinensis RchiOBHm_Chr2g0160621
rosa_laevigata RLG00000021227
rosa_multiflora Rmu_sc0000674.1_g000028
rosa_roxburghii Rroxscaffold_2G00089550
rosa_rugosa Rorug02G0484300
rosa_samantha Rh2AG549400 Rh2BG563800 Rh2CG534000 Rh2DG572800
rosa_wichuraiana Rw2G045510

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 623
Acc65I GGTACC 1 cut(s) 464
AccB1I GGYRCC 1 cut(s) 464
AccBSI CCGCTC 1 cut(s) 432
AciI CCGC 1 cut(s) 430
AclWI GGATC 3 cut(s) 22, 229, 747
AcsI RAATTY 6 cut(s) 69, 172, 200, 367, 580, 685
AdeI CACNNNGTG 1 cut(s) 706
AfaI GTAC 3 cut(s) 169, 466, 524
AfiI CCNNNNNNNGG 4 cut(s) 93, 291, 323, 443
AgsI TTSAA 3 cut(s) 75, 196, 485
AluBI AGCT 3 cut(s) 262, 488, 509
AluI AGCT 3 cut(s) 262, 488, 509
Alw26I GTCTC 3 cut(s) 102, 233, 545
AlwI GGATC 3 cut(s) 22, 229, 747
AoxI GGCC 2 cut(s) 95, 516
ApeKI GCWGC 2 cut(s) 488, 509
ApoI RAATTY 6 cut(s) 69, 172, 200, 367, 580, 685
Asp700I GAANNNNTTC 1 cut(s) 200
Asp718I GGTACC 1 cut(s) 464
AspS9I GGNCC 3 cut(s) 96, 359, 516
AsuHPI GGTGA 2 cut(s) 426, 694
AvaII GGWCC 1 cut(s) 359
AxyI CCTNAGG 1 cut(s) 672
BanI GGYRCC 1 cut(s) 464
BanII GRGCYC 1 cut(s) 51
BbvI GCAGC 2 cut(s) 475, 496
BccI CCATC 2 cut(s) 212, 284
BcgI CGANNNNNNTGC 4 cut(s) 491, 525, 585, 619
BcoDI GTCTC 3 cut(s) 102, 233, 545
BfaI CTAG 2 cut(s) 275, 461
BfmI CTRYAG 2 cut(s) 382, 630
BfuAI ACCTGC 1 cut(s) 623
BisI GCNGC 2 cut(s) 489, 510
BlsI GCNGC 2 cut(s) 490, 511
Bme18I GGWCC 1 cut(s) 359
BmgT120I GGNCC 3 cut(s) 96, 359, 516
BmiI GGNNCC 4 cut(s) 98, 466, 529, 609
BmsI GCATC 1 cut(s) 329
BpmI CTGGAG 1 cut(s) 550
BpuEI CTTGAG 1 cut(s) 97
Bsa29I ATCGAT 1 cut(s) 723
BsaAI YACGTR 1 cut(s) 703
BsaBI GATNNNNATC 2 cut(s) 729, 744
BsaJI CCNNGG 2 cut(s) 321, 753
Bsc4I CCNNNNNNNGG 4 cut(s) 93, 291, 323, 443
Bse1I ACTGG 1 cut(s) 567
Bse21I CCTNAGG 1 cut(s) 672
Bse8I GATNNNNATC 2 cut(s) 729, 744
BseCI ATCGAT 1 cut(s) 723
BseDI CCNNGG 2 cut(s) 321, 753
BseGI GGATG 4 cut(s) 223, 281, 344, 766
BseJI GATNNNNATC 2 cut(s) 729, 744
BseLI CCNNNNNNNGG 4 cut(s) 93, 291, 323, 443
BseMII CTCAG 4 cut(s) 228, 354, 648, 686
BseNI ACTGG 1 cut(s) 567
BseXI GCAGC 2 cut(s) 475, 496
BseYI CCCAGC 1 cut(s) 118
BshFI GGCC 2 cut(s) 97, 518
BshNI GGYRCC 1 cut(s) 464
BshVI ATCGAT 1 cut(s) 723
BslFI GGGAC 1 cut(s) 77
BslI CCNNNNNNNGG 4 cut(s) 93, 291, 323, 443
BsmAI GTCTC 3 cut(s) 102, 233, 545
BsmBI CGTCTC 1 cut(s) 545
BsmFI GGGAC 1 cut(s) 77
BsnI GGCC 2 cut(s) 97, 518
Bsp1286I GDGCHC 1 cut(s) 51
Bsp143I GATC 5 cut(s) 14, 221, 561, 724, 739
BspACI CCGC 1 cut(s) 430
BspANI GGCC 2 cut(s) 97, 518
BspCNI CTCAG 4 cut(s) 229, 355, 649, 685
BspDI ATCGAT 1 cut(s) 723
BspLI GGNNCC 4 cut(s) 98, 466, 529, 609
BspMAI CTGCAG 1 cut(s) 634
BspMI ACCTGC 1 cut(s) 623
BspPI GGATC 3 cut(s) 22, 229, 747
BspT107I GGYRCC 1 cut(s) 464
BsrBI CCGCTC 1 cut(s) 432
BsrI ACTGG 1 cut(s) 567
BssECI CCNNGG 2 cut(s) 321, 753
BssMI GATC 5 cut(s) 14, 221, 561, 724, 739
BssT1I CCWWGG 1 cut(s) 321
Bst4CI ACNGT 1 cut(s) 527
BstBAI YACGTR 1 cut(s) 703
BstDEI CTNAG 5 cut(s) 237, 330, 363, 657, 672
BstF5I GGATG 4 cut(s) 223, 281, 344, 766
BstKTI GATC 5 cut(s) 17, 224, 564, 727, 742
BstMAI GTCTC 3 cut(s) 102, 233, 545
BstMBI GATC 5 cut(s) 14, 221, 561, 724, 739
BstMWI GCNNNNNNNGC 4 cut(s) 103, 485, 494, 515
BstSFI CTRYAG 2 cut(s) 382, 630
BstV1I GCAGC 2 cut(s) 475, 496
BstX2I RGATCY 3 cut(s) 14, 221, 739
BstYI RGATCY 3 cut(s) 14, 221, 739
Bsu15I ATCGAT 1 cut(s) 723
Bsu36I CCTNAGG 1 cut(s) 672
BsuRI GGCC 2 cut(s) 97, 518
BsuTUI ATCGAT 1 cut(s) 723
BtsCI GGATG 4 cut(s) 223, 281, 344, 766
BtsIMutI CAGTG 1 cut(s) 711
BveI ACCTGC 1 cut(s) 623
Cfr13I GGNCC 3 cut(s) 96, 359, 516
ClaI ATCGAT 1 cut(s) 723
Csp6I GTAC 3 cut(s) 168, 465, 523
CviAII CATG 4 cut(s) 44, 343, 405, 520
CviQI GTAC 3 cut(s) 168, 465, 523
DdeI CTNAG 5 cut(s) 237, 330, 363, 657, 672
DpnI GATC 5 cut(s) 16, 223, 563, 726, 741
DpnII GATC 5 cut(s) 14, 221, 561, 724, 739
DraIII CACNNNGTG 1 cut(s) 706
Eco130I CCWWGG 1 cut(s) 321
Eco24I GRGCYC 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 359
Eco81I CCTNAGG 1 cut(s) 672
EcoO109I RGGNCCY 1 cut(s) 359
EcoRI GAATTC 2 cut(s) 367, 685
EcoT14I CCWWGG 1 cut(s) 321
EcoT22I ATGCAT 1 cut(s) 344
EcoT38I GRGCYC 1 cut(s) 51
ErhI CCWWGG 1 cut(s) 321
Esp3I CGTCTC 1 cut(s) 545
FaeI CATG 4 cut(s) 47, 346, 408, 523
FaiI YATR 8 cut(s) 45, 59, 185, 207, 344, 406, 521, 750
FalI AAGNNNNNCTT 2 cut(s) 477, 509
FaqI GGGAC 1 cut(s) 77
FatI CATG 4 cut(s) 43, 342, 404, 519
Fnu4HI GCNGC 2 cut(s) 489, 510
FokI GGATG 3 cut(s) 230, 268, 351
FriOI GRGCYC 1 cut(s) 51
Fsp4HI GCNGC 2 cut(s) 489, 510
FspBI CTAG 2 cut(s) 275, 461
GluI GCNGC 2 cut(s) 489, 510
GsaI CCCAGC 1 cut(s) 122
GsuI CTGGAG 1 cut(s) 550
HaeIII GGCC 2 cut(s) 97, 518
Hin1II CATG 4 cut(s) 47, 346, 408, 523
HinfI GANTC 5 cut(s) 110, 124, 241, 278, 641
HphI GGTGA 2 cut(s) 426, 694
Hpy166II GTNNAC 3 cut(s) 212, 299, 709
Hpy188I TCNGA 3 cut(s) 552, 640, 658
Hpy188III TCNNGA 3 cut(s) 275, 372, 674
Hpy8I GTNNAC 3 cut(s) 212, 299, 709
HpyAV CCTTC 3 cut(s) 328, 547, 621
HpyCH4III ACNGT 1 cut(s) 527
HpyCH4IV ACGT 1 cut(s) 702
HpyCH4V TGCA 6 cut(s) 57, 342, 422, 479, 512, 632
HpyF10VI GCNNNNNNNGC 4 cut(s) 103, 485, 494, 515
HpyF3I CTNAG 5 cut(s) 237, 330, 363, 657, 672
HpySE526I ACGT 1 cut(s) 702
Hsp92II CATG 4 cut(s) 47, 346, 408, 523
KpnI GGTACC 1 cut(s) 468
Kzo9I GATC 5 cut(s) 14, 221, 561, 724, 739
LmnI GCTCC 2 cut(s) 131, 613
Lsp1109I GCAGC 2 cut(s) 475, 496
LweI GCATC 1 cut(s) 329
MaeI CTAG 2 cut(s) 275, 461
MaeII ACGT 1 cut(s) 702
MaeIII GTNAC 6 cut(s) 125, 377, 556, 569, 622, 650
MalI GATC 5 cut(s) 16, 223, 563, 726, 741
MbiI CCGCTC 1 cut(s) 432
MboI GATC 5 cut(s) 14, 221, 561, 724, 739
MboII GAAGA 1 cut(s) 576
MfeI CAATTG 2 cut(s) 101, 480
MflI RGATCY 3 cut(s) 14, 221, 739
MhlI GDGCHC 1 cut(s) 51
MluCI AATT 9 cut(s) 69, 88, 101, 172, 200, 367, 480, 580, 685
MlyI GAGTC 3 cut(s) 104, 133, 235
MmeI TCCRAC 1 cut(s) 497
MnlI CCTC 9 cut(s) 350, 380, 393, 541, 652, 681, 708, 748, 751
Mph1103I ATGCAT 1 cut(s) 344
MroXI GAANNNNTTC 1 cut(s) 200
MseI TTAA 1 cut(s) 264
MunI CAATTG 2 cut(s) 101, 480
MwoI GCNNNNNNNGC 4 cut(s) 103, 485, 494, 515
NdeII GATC 5 cut(s) 14, 221, 561, 724, 739
NlaIII CATG 4 cut(s) 47, 346, 408, 523
NlaIV GGNNCC 4 cut(s) 98, 466, 529, 609
NmuCI GTSAC 3 cut(s) 125, 622, 650
NsiI ATGCAT 1 cut(s) 344
PdmI GAANNNNTTC 1 cut(s) 200
PfeI GAWTC 2 cut(s) 278, 641
PkrI GCNGC 2 cut(s) 490, 511
PleI GAGTC 3 cut(s) 104, 132, 235
PpsI GAGTC 3 cut(s) 104, 132, 235
Ppu21I YACGTR 1 cut(s) 703
PpuMI RGGWCCY 1 cut(s) 359
Psp5II RGGWCCY 1 cut(s) 359
PspFI CCCAGC 1 cut(s) 118
PspN4I GGNNCC 4 cut(s) 98, 466, 529, 609
PspPI GGNCC 3 cut(s) 96, 359, 516
PspPPI RGGWCCY 1 cut(s) 359
PsrI GAACNNNNNNTAC 2 cut(s) 146, 178
PstI CTGCAG 1 cut(s) 634
PsuI RGATCY 3 cut(s) 14, 221, 739
RsaI GTAC 3 cut(s) 169, 466, 524
RsaNI GTAC 3 cut(s) 168, 465, 523
SaqAI TTAA 1 cut(s) 264
SatI GCNGC 2 cut(s) 489, 510
Sau3AI GATC 5 cut(s) 14, 221, 561, 724, 739
Sau96I GGNCC 3 cut(s) 96, 359, 516
SchI GAGTC 3 cut(s) 104, 133, 235
SduI GDGCHC 1 cut(s) 51
SfaNI GCATC 1 cut(s) 329
SfcI CTRYAG 2 cut(s) 382, 630
SinI GGWCC 1 cut(s) 359
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
Sse9I AATT 9 cut(s) 69, 88, 101, 172, 200, 367, 480, 580, 685
SsiI CCGC 1 cut(s) 430
SspMI CTAG 2 cut(s) 275, 461
StyI CCWWGG 1 cut(s) 321
TaaI ACNGT 1 cut(s) 527
TaiI ACGT 1 cut(s) 705
TaqI TCGA 2 cut(s) 373, 723
TasI AATT 9 cut(s) 69, 88, 101, 172, 200, 367, 480, 580, 685
TatI WGTACW 1 cut(s) 167
TfiI GAWTC 2 cut(s) 278, 641
Tru1I TTAA 1 cut(s) 264
Tru9I TTAA 1 cut(s) 264
TscAI CASTG 1 cut(s) 718
TseFI GTSAC 3 cut(s) 125, 622, 650
TseI GCWGC 2 cut(s) 488, 509
Tsp45I GTSAC 3 cut(s) 125, 622, 650
TspDTI ATGAA 4 cut(s) 17, 32, 359, 519
TspGWI ACGGA 1 cut(s) 144
TspRI CASTG 1 cut(s) 718
VpaK11BI GGWCC 1 cut(s) 359
XapI RAATTY 6 cut(s) 69, 172, 200, 367, 580, 685
XbaI TCTAGA 1 cut(s) 274
XcmI CCANNNNNNNNNTGG 1 cut(s) 33
XmnI GAANNNNTTC 1 cut(s) 200
XspI CTAG 2 cut(s) 275, 461
Zsp2I ATGCAT 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.