Rmu_sc0000981.1_g000004

protein At1g32220, chloroplastic-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000981.1
OG0012254
Physical Location & Seq
Forward (+)
13537 .. 24310
10774 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000981.1_g000004.1.cds

Sequence Viewer

Length: 900 bp
atgtcgactgtaaggctcgggcttgggttggttttggatgctggttcgattgctggtgatggttttgctaagtggtggtcagaaatggtgttttccggtgctggcagtgggaggagagagagagaggtaggggagaaagagagagaagggaggacgcgactgcaagggaggaaggagaaaaatgaggctaggtcctctaaattccgacgatcagaattttcaaatactggccaaaaccgaccattgaaagcagtaactgcaagctccggcaacacatttggcttaaccgaagagtttcggtctggtaggtcaaagttacatgattcatgggctaacaatgtgaactggtaccaaggaaaccttctatcacctgattcatggaaggatgctcttgacggtgtcacgtctgttatatcctgcgttggtggctttggctccaattcttacatgtataagattaatgggactgcaaacatcaatgcaattagagctgcttctgagcatggtgtgaaaagatttgtgtatgtctctgctgctgattttggcttggtaaattacttgctgcgaggatattatgagggaaagagagctgccgaaacagagatactaaccaaattcccttatggaggagtgattttgaggcctggatttatttacgggactcgaagtgttgggagcataaagttacctcttggtgtaatcggttctcctctggagatgttatttcaacaaacaagacctctgaaccagctgccactagtgggacctctctttactcctcctgtgaatgttactgctgtagcgaaggttgctgttagagcagctaccgatcccgtcttccctcctgggattgttgatatctacgggattcaacgttatactcagcataagtccaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAD_binding_10

Protein Analysis

299

Amino Acids

32.69

Weight (kDa)

9.9

Isoelectric Point (pI)

40.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012254)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G10730
fragaria_vesca FvH4_2g41440 FvH4_2g41440
malus_domestica MD08G1049300.v1.1 MD15G1045600.v1.1
prunus_persica Prupe.1G399300_v2.0.a1
pyrus_communis pycom08g04120 pycom15g04250
rosa_chinensis RchiOBHm_Chr6g0299041
rosa_laevigata RLG00000011467
rosa_multiflora Rmu_sc0000981.1_g000004 Rmu_sc0032629.1_g000004
rosa_roxburghii Rroxscaffold_7G00169060
rosa_rugosa Rorug06G0284300
rosa_samantha Rh6AG395800 Rh6BG404400 Rh6CG410300 Rh6DG397000
rosa_wichuraiana Rw6G034640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 348
AccB1I GGYRCC 1 cut(s) 348
AccI GTMKAC 1 cut(s) 5
AccII CGCG 1 cut(s) 157
AclI AACGTT 1 cut(s) 874
AclWI GGATC 1 cut(s) 824
AcoI YGGCCR 1 cut(s) 229
AcsI RAATTY 3 cut(s) 200, 215, 614
AfaI GTAC 1 cut(s) 350
AfiI CCNNNNNNNGG 2 cut(s) 626, 761
AflIII ACRYGT 1 cut(s) 447
AgsI TTSAA 4 cut(s) 222, 247, 728, 872
AhlI ACTAGT 1 cut(s) 757
AjiI CACGTC 1 cut(s) 405
AjnI CCWGG 2 cut(s) 643, 844
AjuI GAANNNNNNNTTGG 2 cut(s) 345, 377
AluBI AGCT 5 cut(s) 264, 491, 590, 751, 824
AluI AGCT 5 cut(s) 264, 491, 590, 751, 824
Alw26I GTCTC 1 cut(s) 532
AlwI GGATC 1 cut(s) 824
AlwNI CAGNNNCTG 1 cut(s) 257
Ama87I CYCGRG 1 cut(s) 17
AoxI GGCC 2 cut(s) 229, 641
ApeKI GCWGC 6 cut(s) 491, 533, 562, 590, 751, 821
ApoI RAATTY 3 cut(s) 200, 215, 614
AseI ATTAAT 1 cut(s) 459
Asp700I GAANNNNTTC 1 cut(s) 294
Asp718I GGTACC 1 cut(s) 348
AspS9I GGNCC 2 cut(s) 192, 764
AsuHPI GGTGA 2 cut(s) 68, 360
AvaI CYCGRG 1 cut(s) 17
AvaII GGWCC 2 cut(s) 192, 764
BalI TGGCCA 1 cut(s) 231
BanI GGYRCC 1 cut(s) 348
BbsI GAAGAC 1 cut(s) 829
BbvI GCAGC 6 cut(s) 478, 520, 549, 577, 738, 833
BccI CCATC 1 cut(s) 53
BciT130I CCWGG 2 cut(s) 645, 846
BcoDI GTCTC 1 cut(s) 532
BcuI ACTAGT 1 cut(s) 757
BfaI CTAG 2 cut(s) 189, 758
BfmI CTRYAG 1 cut(s) 798
BisI GCNGC 6 cut(s) 492, 534, 563, 591, 752, 822
BlsI GCNGC 6 cut(s) 493, 535, 564, 592, 753, 823
Bme1390I CCNGG 2 cut(s) 645, 846
Bme18I GGWCC 2 cut(s) 192, 764
BmeT110I CYCGRG 1 cut(s) 17
BmgBI CACGTC 1 cut(s) 405
BmgT120I GGNCC 2 cut(s) 192, 764
BmiI GGNNCC 3 cut(s) 350, 436, 765
BmrFI CCNGG 2 cut(s) 645, 846
BmsI GCATC 2 cut(s) 28, 376
BpiI GAAGAC 1 cut(s) 829
BpmI CTGGAG 1 cut(s) 734
BsaJI CCNNGG 2 cut(s) 352, 845
BsaWI WCCGGW 1 cut(s) 95
Bsc4I CCNNNNNNNGG 2 cut(s) 626, 761
Bse1I ACTGG 2 cut(s) 232, 350
BseBI CCWGG 2 cut(s) 645, 846
BseDI CCNNGG 2 cut(s) 352, 845
BseGI GGATG 2 cut(s) 43, 391
BseLI CCNNNNNNNGG 2 cut(s) 626, 761
BseMII CTCAG 2 cut(s) 489, 896
BseNI ACTGG 2 cut(s) 232, 350
BseRI GAGGAG 4 cut(s) 127, 642, 699, 768
BseXI GCAGC 6 cut(s) 478, 520, 549, 577, 738, 833
Bsh1236I CGCG 1 cut(s) 157
BshFI GGCC 2 cut(s) 231, 643
BshNI GGYRCC 1 cut(s) 348
BsiHKCI CYCGRG 1 cut(s) 17
BsiSI CCGG 2 cut(s) 96, 267
BslFI GGGAC 3 cut(s) 478, 673, 777
BslI CCNNNNNNNGG 2 cut(s) 626, 761
BsmAI GTCTC 1 cut(s) 532
BsmFI GGGAC 3 cut(s) 478, 673, 777
BsnI GGCC 2 cut(s) 231, 643
BsoBI CYCGRG 1 cut(s) 17
Bsp143I GATC 2 cut(s) 209, 829
BspANI GGCC 2 cut(s) 231, 643
BspCNI CTCAG 2 cut(s) 490, 895
BspFNI CGCG 1 cut(s) 157
BspLI GGNNCC 3 cut(s) 350, 436, 765
BspPI GGATC 1 cut(s) 824
BspT107I GGYRCC 1 cut(s) 348
BsrI ACTGG 2 cut(s) 232, 350
BssECI CCNNGG 2 cut(s) 352, 845
BssMI GATC 2 cut(s) 209, 829
BssT1I CCWWGG 1 cut(s) 352
Bst2UI CCWGG 2 cut(s) 645, 846
Bst4CI ACNGT 2 cut(s) 10, 398
Bst6I CTCTTC 1 cut(s) 285
BstAPI GCANNNNNTGC 1 cut(s) 257
BstC8I GCNNGC 2 cut(s) 103, 262
BstDEI CTNAG 3 cut(s) 69, 498, 882
BstENI CCTNNNNNAGG 1 cut(s) 624
BstF5I GGATG 2 cut(s) 43, 391
BstFNI CGCG 1 cut(s) 157
BstKTI GATC 2 cut(s) 212, 832
BstMAI GTCTC 1 cut(s) 532
BstMBI GATC 2 cut(s) 209, 829
BstMWI GCNNNNNNNGC 5 cut(s) 257, 426, 488, 809, 818
BstNI CCWGG 2 cut(s) 645, 846
BstNSI RCATGY 1 cut(s) 451
BstSCI CCNGG 2 cut(s) 643, 844
BstSFI CTRYAG 1 cut(s) 798
BstUI CGCG 1 cut(s) 157
BstV1I GCAGC 6 cut(s) 478, 520, 549, 577, 738, 833
BstV2I GAAGAC 1 cut(s) 829
BsuRI GGCC 2 cut(s) 231, 643
BtrI CACGTC 1 cut(s) 405
BtsCI GGATG 2 cut(s) 43, 391
BtsI GCAGTG 1 cut(s) 112
BtsIMutI CAGTG 1 cut(s) 112
Cac8I GCNNGC 2 cut(s) 103, 262
CaiI CAGNNNCTG 1 cut(s) 257
Cfr13I GGNCC 2 cut(s) 192, 764
CseI GACGC 1 cut(s) 163
Csp6I GTAC 1 cut(s) 349
CviAII CATG 5 cut(s) 320, 327, 378, 448, 503
CviQI GTAC 1 cut(s) 349
DdeI CTNAG 3 cut(s) 69, 498, 882
DpnI GATC 2 cut(s) 211, 831
DpnII GATC 2 cut(s) 209, 829
EaeI YGGCCR 1 cut(s) 229
Eam1104I CTCTTC 1 cut(s) 285
EarI CTCTTC 1 cut(s) 285
Eco130I CCWWGG 1 cut(s) 352
Eco147I AGGCCT 1 cut(s) 643
Eco32I GATATC 1 cut(s) 859
Eco47I GGWCC 2 cut(s) 192, 764
Eco88I CYCGRG 1 cut(s) 17
EcoNI CCTNNNNNAGG 1 cut(s) 624
EcoO109I RGGNCCY 2 cut(s) 192, 764
EcoRII CCWGG 2 cut(s) 643, 844
EcoRV GATATC 1 cut(s) 859
EcoT14I CCWWGG 1 cut(s) 352
ErhI CCWWGG 1 cut(s) 352
FaeI CATG 5 cut(s) 323, 330, 381, 451, 506
FalI AAGNNNNNCTT 2 cut(s) 345, 377
FaqI GGGAC 3 cut(s) 478, 673, 777
FatI CATG 5 cut(s) 319, 326, 377, 447, 502
FblI GTMKAC 1 cut(s) 5
Fnu4HI GCNGC 6 cut(s) 492, 534, 563, 591, 752, 822
FokI GGATG 2 cut(s) 50, 398
Fsp4HI GCNGC 6 cut(s) 492, 534, 563, 591, 752, 822
FspBI CTAG 2 cut(s) 189, 758
GluI GCNGC 6 cut(s) 492, 534, 563, 591, 752, 822
GsuI CTGGAG 1 cut(s) 734
HaeIII GGCC 2 cut(s) 231, 643
HapII CCGG 2 cut(s) 96, 267
HgaI GACGC 1 cut(s) 163
Hin1II CATG 5 cut(s) 323, 330, 381, 451, 506
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 4 cut(s) 323, 374, 661, 868
HpaII CCGG 2 cut(s) 96, 267
HphI GGTGA 2 cut(s) 68, 360
Hpy166II GTNNAC 2 cut(s) 6, 343
Hpy188I TCNGA 5 cut(s) 82, 206, 214, 499, 744
Hpy188III TCNNGA 2 cut(s) 392, 713
Hpy8I GTNNAC 2 cut(s) 6, 343
Hpy99I CGWCG 1 cut(s) 210
HpyAV CCTTC 5 cut(s) 140, 166, 371, 376, 799
HpyCH4III ACNGT 2 cut(s) 10, 398
HpyCH4IV ACGT 2 cut(s) 404, 874
HpyCH4V TGCA 4 cut(s) 163, 260, 470, 482
HpyF10VI GCNNNNNNNGC 5 cut(s) 257, 426, 488, 809, 818
HpyF3I CTNAG 3 cut(s) 69, 498, 882
HpySE526I ACGT 2 cut(s) 404, 874
Hsp92II CATG 5 cut(s) 323, 330, 381, 451, 506
KpnI GGTACC 1 cut(s) 352
Kzo9I GATC 2 cut(s) 209, 829
LmnI GCTCC 3 cut(s) 269, 440, 675
Lsp1109I GCAGC 6 cut(s) 478, 520, 549, 577, 738, 833
LweI GCATC 2 cut(s) 28, 376
MaeI CTAG 2 cut(s) 189, 758
MaeII ACGT 2 cut(s) 404, 874
MaeIII GTNAC 5 cut(s) 253, 315, 400, 684, 790
MalI GATC 2 cut(s) 211, 831
MboI GATC 2 cut(s) 209, 829
MboII GAAGA 2 cut(s) 302, 829
MlsI TGGCCA 1 cut(s) 231
MluCI AATT 6 cut(s) 200, 215, 439, 483, 553, 614
MluNI TGGCCA 1 cut(s) 231
MlyI GAGTC 1 cut(s) 655
MmeI TCCRAC 1 cut(s) 229
Mox20I TGGCCA 1 cut(s) 231
MroXI GAANNNNTTC 1 cut(s) 294
MscI TGGCCA 1 cut(s) 231
MseI TTAA 2 cut(s) 284, 459
Msp20I TGGCCA 1 cut(s) 231
MspA1I CMGCKG 1 cut(s) 751
MspI CCGG 2 cut(s) 96, 267
MspR9I CCNGG 2 cut(s) 645, 846
MvaI CCWGG 2 cut(s) 645, 846
MvnI CGCG 1 cut(s) 157
MwoI GCNNNNNNNGC 5 cut(s) 257, 426, 488, 809, 818
NdeII GATC 2 cut(s) 209, 829
NlaIII CATG 5 cut(s) 323, 330, 381, 451, 506
NlaIV GGNNCC 3 cut(s) 350, 436, 765
NmuCI GTSAC 1 cut(s) 400
NspI RCATGY 1 cut(s) 451
PceI AGGCCT 1 cut(s) 643
PciI ACATGT 1 cut(s) 447
PdmI GAANNNNTTC 1 cut(s) 294
PfeI GAWTC 3 cut(s) 323, 374, 868
PflFI GACNNNGTC 1 cut(s) 398
PkrI GCNGC 6 cut(s) 493, 535, 564, 592, 753, 823
PleI GAGTC 1 cut(s) 655
PpsI GAGTC 1 cut(s) 655
PpuMI RGGWCCY 2 cut(s) 192, 764
PscI ACATGT 1 cut(s) 447
PshBI ATTAAT 1 cut(s) 459
Psp1406I AACGTT 1 cut(s) 874
Psp5II RGGWCCY 2 cut(s) 192, 764
Psp6I CCWGG 2 cut(s) 643, 844
PspGI CCWGG 2 cut(s) 643, 844
PspN4I GGNNCC 3 cut(s) 350, 436, 765
PspPI GGNCC 2 cut(s) 192, 764
PspPPI RGGWCCY 2 cut(s) 192, 764
PstNI CAGNNNCTG 1 cut(s) 257
PsyI GACNNNGTC 1 cut(s) 398
PvuII CAGCTG 1 cut(s) 751
RsaI GTAC 1 cut(s) 350
RsaNI GTAC 1 cut(s) 349
SalI GTCGAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 284, 459
SatI GCNGC 6 cut(s) 492, 534, 563, 591, 752, 822
Sau3AI GATC 2 cut(s) 209, 829
Sau96I GGNCC 2 cut(s) 192, 764
SchI GAGTC 1 cut(s) 655
ScrFI CCNGG 2 cut(s) 645, 846
SfaNI GCATC 2 cut(s) 28, 376
SfcI CTRYAG 1 cut(s) 798
SinI GGWCC 2 cut(s) 192, 764
SpeI ACTAGT 1 cut(s) 757
Sse9I AATT 6 cut(s) 200, 215, 439, 483, 553, 614
SseBI AGGCCT 1 cut(s) 643
SspMI CTAG 2 cut(s) 189, 758
StuI AGGCCT 1 cut(s) 643
StyD4I CCNGG 2 cut(s) 643, 844
StyI CCWWGG 1 cut(s) 352
TaaI ACNGT 2 cut(s) 10, 398
TaiI ACGT 2 cut(s) 407, 877
TaqI TCGA 3 cut(s) 5, 47, 664
TaqII GACCGA 1 cut(s) 288
TasI AATT 6 cut(s) 200, 215, 439, 483, 553, 614
TfiI GAWTC 3 cut(s) 323, 374, 868
Tru1I TTAA 2 cut(s) 284, 459
Tru9I TTAA 2 cut(s) 284, 459
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 400
TseI GCWGC 6 cut(s) 491, 533, 562, 590, 751, 821
Tsp45I GTSAC 1 cut(s) 400
TspDTI ATGAA 2 cut(s) 315, 366
TspRI CASTG 1 cut(s) 112
Tth111I GACNNNGTC 1 cut(s) 398
VpaK11BI GGWCC 2 cut(s) 192, 764
VspI ATTAAT 1 cut(s) 459
XagI CCTNNNNNAGG 1 cut(s) 624
XapI RAATTY 3 cut(s) 200, 215, 614
XceI RCATGY 1 cut(s) 451
XmiI GTMKAC 1 cut(s) 5
XmnI GAANNNNTTC 1 cut(s) 294
XspI CTAG 2 cut(s) 189, 758
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.