Rmu_sc0001060.1_g000010

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001060.1
OG0014634
Physical Location & Seq
Reverse (-)
36584 .. 37150
567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001060.1_g000010.1.cds

Sequence Viewer

Length: 567 bp
atggctctctctgtggttcatgttctacttcttgccctcctcttagctaaagccacctctacctctcaccaccaccaccaccaccaccatcatcatcaccacgaaaaactcaagtccctccactttgcactctttcaacatgagaccattaacaaaaccggatacattgtagttaatggtgtagccggaacagctgttagtcaaaccacaacgcctttcggcaccctgtttgctttccaggatccgatgactgtcacagccaatcgatcttcaaaggtagctgggatagctcaaggaacttccatcacttccagcttggatgggcttgagagcatttcaattgctaagataaccttgcggttgaagcactacagtggttcgatttccattgttggaggcacacataatatcaagcctgctgatcatcctgttgtcggaggcaccggtgatttcaagcttgtccagggctatgtgacatcatctccggtcaatctcatgggcttaactgttacctacaagattgcattccacctttactggcctccctatgcaactcaagcttcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

188

Amino Acids

20.24

Weight (kDa)

9.52

Isoelectric Point (pI)

20.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014634)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g10500
malus_domestica MD02G1118100.v1.1 MD02G1118400.v1.1
prunus_persica Prupe.7G181300_v2.0.a1
pyrus_communis pycom02g09170 pycom02g09180 pycom15g20710
rosa_chinensis RchiOBHm_Chr2g0097361
rosa_laevigata RLG00000016720
rosa_multiflora Rmu_sc0001060.1_g000010
rosa_roxburghii Rroxscaffold_2G00144740
rosa_rugosa Rorug02G0066000
rosa_samantha Rh2AG112800 Rh2BG115600 Rh2CG117800 Rh2DG116800
rosa_wichuraiana Rw2G008830

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 221, 440
AciI CCGC 1 cut(s) 358
AclWI GGATC 2 cut(s) 236, 249
AfiI CCNNNNNNNGG 1 cut(s) 434
AgeI ACCGGT 1 cut(s) 443
AgsI TTSAA 5 cut(s) 137, 273, 339, 364, 454
AjnI CCWGG 2 cut(s) 237, 462
AleI CACNNNNGTG 1 cut(s) 372
AluBI AGCT 7 cut(s) 47, 194, 281, 290, 315, 457, 560
AluI AGCT 7 cut(s) 47, 194, 281, 290, 315, 457, 560
Alw26I GTCTC 1 cut(s) 137
AlwI GGATC 2 cut(s) 236, 249
AoxI GGCC 1 cut(s) 539
AsiGI ACCGGT 1 cut(s) 443
AsuHPI GGTGA 3 cut(s) 59, 89, 458
BamHI GGATCC 1 cut(s) 241
BanI GGYRCC 2 cut(s) 221, 440
BccI CCATC 3 cut(s) 96, 311, 314
BciT130I CCWGG 2 cut(s) 239, 464
BciVI GTATCC 1 cut(s) 155
BclI TGATCA 1 cut(s) 421
BcoDI GTCTC 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 370
BfuI GTATCC 1 cut(s) 155
Bme1390I CCNGG 2 cut(s) 239, 464
BmiI GGNNCC 3 cut(s) 223, 243, 442
BmrFI CCNGG 2 cut(s) 239, 464
BpuEI CTTGAG 4 cut(s) 95, 276, 347, 540
Bsa29I ATCGAT 1 cut(s) 265
BsaI GGTCTC 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 463
BsaWI WCCGGW 3 cut(s) 158, 443, 484
BsaXI ACNNNNNCTCC 2 cut(s) 466, 496
Bsc4I CCNNNNNNNGG 1 cut(s) 434
Bse118I RCCGGY 1 cut(s) 443
Bse1I ACTGG 1 cut(s) 542
BseBI CCWGG 2 cut(s) 239, 464
BseCI ATCGAT 1 cut(s) 265
BseDI CCNNGG 1 cut(s) 463
BseGI GGATG 2 cut(s) 325, 424
BseLI CCNNNNNNNGG 1 cut(s) 434
BseNI ACTGG 1 cut(s) 542
BseRI GAGGAG 1 cut(s) 29
BseYI CCCAGC 1 cut(s) 281
BshFI GGCC 1 cut(s) 541
BshNI GGYRCC 2 cut(s) 221, 440
BshTI ACCGGT 1 cut(s) 443
BshVI ATCGAT 1 cut(s) 265
BsiSI CCGG 4 cut(s) 159, 186, 444, 485
BslFI GGGAC 1 cut(s) 100
BslI CCNNNNNNNGG 1 cut(s) 434
BsmAI GTCTC 1 cut(s) 137
BsmFI GGGAC 1 cut(s) 100
BsmI GAATGC 1 cut(s) 524
BsnI GGCC 1 cut(s) 541
Bso31I GGTCTC 1 cut(s) 137
Bsp143I GATC 3 cut(s) 241, 266, 421
BspACI CCGC 1 cut(s) 358
BspANI GGCC 1 cut(s) 541
BspDI ATCGAT 1 cut(s) 265
BspLI GGNNCC 3 cut(s) 223, 243, 442
BspPI GGATC 2 cut(s) 236, 249
BspT107I GGYRCC 2 cut(s) 221, 440
BspTNI GGTCTC 1 cut(s) 137
BsrFI RCCGGY 1 cut(s) 443
BsrI ACTGG 1 cut(s) 542
BssAI RCCGGY 1 cut(s) 443
BssECI CCNNGG 1 cut(s) 463
BssMI GATC 3 cut(s) 241, 266, 421
Bst2UI CCWGG 2 cut(s) 239, 464
Bst4CI ACNGT 3 cut(s) 253, 374, 508
BstC8I GCNNGC 1 cut(s) 417
BstDEI CTNAG 2 cut(s) 43, 345
BstF5I GGATG 2 cut(s) 325, 424
BstKTI GATC 3 cut(s) 244, 269, 424
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 3 cut(s) 241, 266, 421
BstMWI GCNNNNNNNGC 4 cut(s) 191, 287, 364, 557
BstNI CCWGG 2 cut(s) 239, 464
BstSCI CCNGG 2 cut(s) 237, 462
BstSFI CTRYAG 1 cut(s) 370
BstX2I RGATCY 1 cut(s) 241
BstYI RGATCY 1 cut(s) 241
Bsu15I ATCGAT 1 cut(s) 265
BsuI GTATCC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 541
BsuTUI ATCGAT 1 cut(s) 265
BtsCI GGATG 2 cut(s) 325, 424
BtsIMutI CAGTG 1 cut(s) 379
Cac8I GCNNGC 1 cut(s) 417
Cfr10I RCCGGY 1 cut(s) 443
ClaI ATCGAT 1 cut(s) 265
CspAI ACCGGT 1 cut(s) 443
CviAII CATG 3 cut(s) 20, 140, 496
DdeI CTNAG 2 cut(s) 43, 345
DpnI GATC 3 cut(s) 243, 268, 423
DpnII GATC 3 cut(s) 241, 266, 421
Eco31I GGTCTC 1 cut(s) 137
EcoRII CCWGG 2 cut(s) 237, 462
FaeI CATG 3 cut(s) 23, 143, 499
FaiI YATR 6 cut(s) 21, 141, 405, 471, 497, 549
FalI AAGNNNNNCTT 2 cut(s) 338, 370
FaqI GGGAC 1 cut(s) 100
FatI CATG 3 cut(s) 19, 139, 495
FbaI TGATCA 1 cut(s) 421
FokI GGATG 2 cut(s) 332, 411
GsaI CCCAGC 1 cut(s) 285
HaeIII GGCC 1 cut(s) 541
HapII CCGG 4 cut(s) 159, 186, 444, 485
Hin1II CATG 3 cut(s) 23, 143, 499
HindIII AAGCTT 2 cut(s) 455, 558
HpaII CCGG 4 cut(s) 159, 186, 444, 485
HphI GGTGA 3 cut(s) 59, 89, 458
Hpy188I TCNGA 2 cut(s) 246, 437
HpyCH4III ACNGT 3 cut(s) 253, 374, 508
HpyCH4V TGCA 3 cut(s) 128, 524, 551
HpyF10VI GCNNNNNNNGC 4 cut(s) 191, 287, 364, 557
HpyF3I CTNAG 2 cut(s) 43, 345
Hsp92II CATG 3 cut(s) 23, 143, 499
Ksp22I TGATCA 1 cut(s) 421
Kzo9I GATC 3 cut(s) 241, 266, 421
MaeIII GTNAC 3 cut(s) 253, 472, 508
MalI GATC 3 cut(s) 243, 268, 423
MboI GATC 3 cut(s) 241, 266, 421
MboII GAAGA 1 cut(s) 261
MfeI CAATTG 1 cut(s) 339
MflI RGATCY 1 cut(s) 241
MluCI AATT 1 cut(s) 339
MmeI TCCRAC 2 cut(s) 373, 415
MnlI CCTC 8 cut(s) 47, 50, 67, 73, 128, 389, 431, 552
MseI TTAA 4 cut(s) 150, 174, 503, 565
MslI CAYNNNNRTG 1 cut(s) 372
MspA1I CMGCKG 1 cut(s) 194
MspI CCGG 4 cut(s) 159, 186, 444, 485
MspR9I CCNGG 2 cut(s) 239, 464
MunI CAATTG 1 cut(s) 339
Mva1269I GAATGC 1 cut(s) 524
MvaI CCWGG 2 cut(s) 239, 464
MwoI GCNNNNNNNGC 4 cut(s) 191, 287, 364, 557
NdeII GATC 3 cut(s) 241, 266, 421
NlaIII CATG 3 cut(s) 23, 143, 499
NlaIV GGNNCC 3 cut(s) 223, 243, 442
NmuCI GTSAC 2 cut(s) 253, 472
OliI CACNNNNGTG 1 cut(s) 372
PctI GAATGC 1 cut(s) 524
PfoI TCCNGGA 1 cut(s) 237
PinAI ACCGGT 1 cut(s) 443
Psp6I CCWGG 2 cut(s) 237, 462
PspFI CCCAGC 1 cut(s) 281
PspGI CCWGG 2 cut(s) 237, 462
PspN4I GGNNCC 3 cut(s) 223, 243, 442
PsuI RGATCY 1 cut(s) 241
PvuII CAGCTG 1 cut(s) 194
RseI CAYNNNNRTG 1 cut(s) 372
SaqAI TTAA 4 cut(s) 150, 174, 503, 565
Sau3AI GATC 3 cut(s) 241, 266, 421
ScrFI CCNGG 2 cut(s) 239, 464
SfcI CTRYAG 1 cut(s) 370
SgrAI CRCCGGYG 1 cut(s) 443
SmiMI CAYNNNNRTG 1 cut(s) 372
SmlI CTYRAG 4 cut(s) 110, 291, 326, 555
SmoI CTYRAG 4 cut(s) 110, 291, 326, 555
Sse9I AATT 1 cut(s) 339
SsiI CCGC 1 cut(s) 358
StyD4I CCNGG 2 cut(s) 237, 462
TaaI ACNGT 3 cut(s) 253, 374, 508
TaqI TCGA 2 cut(s) 265, 380
TasI AATT 1 cut(s) 339
Tru1I TTAA 4 cut(s) 150, 174, 503, 565
Tru9I TTAA 4 cut(s) 150, 174, 503, 565
TscAI CASTG 1 cut(s) 379
TseFI GTSAC 2 cut(s) 253, 472
Tsp45I GTSAC 2 cut(s) 253, 472
TspDTI ATGAA 1 cut(s) 8
TspRI CASTG 1 cut(s) 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.