Rh2AG112800

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
10085719 .. 10086039
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG112800.1

Sequence Viewer

Length: 321 bp
ATGACTGTCACAGCCAATCGATCTTCAAAGGTAGCTGGGATAGCTCAAGGAACTTCCATCACTTCCAGCTTGGATGGGCTTGAGAGCATTTCAATTGCTAAGATAACCTTGCGGTTGAAGCACTACAGTGGTTCGATTTCCATTGTTGGAGGCACACATAATATCAAGCCTGCTGATCATCCTGTTGTCGGAGGCACCGGTGATTTCAAGCTTGTCCAGGGCTATGTGACATCATCTCCGGTCAATCTCATGGGCTTAACTGTTACCTACAAGATTGCATTCCACCTTTACTGGCCTCCCTATGCAACTCAAGCTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.15

Weight (kDa)

9.57

Isoelectric Point (pI)

29.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 1 - 85 2e-16 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014634)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 194
AciI CCGC 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 188
AgeI ACCGGT 1 cut(s) 197
AgsI TTSAA 4 cut(s) 27, 93, 118, 208
AjnI CCWGG 1 cut(s) 216
AleI CACNNNNGTG 1 cut(s) 126
AluBI AGCT 5 cut(s) 35, 44, 69, 211, 314
AluI AGCT 5 cut(s) 35, 44, 69, 211, 314
AoxI GGCC 1 cut(s) 293
AsiGI ACCGGT 1 cut(s) 197
AsuHPI GGTGA 1 cut(s) 212
BanI GGYRCC 1 cut(s) 194
BccI CCATC 2 cut(s) 65, 68
BciT130I CCWGG 1 cut(s) 218
BclI TGATCA 1 cut(s) 175
BfmI CTRYAG 1 cut(s) 124
Bme1390I CCNGG 1 cut(s) 218
BmiI GGNNCC 1 cut(s) 196
BmrFI CCNGG 1 cut(s) 218
BpuEI CTTGAG 3 cut(s) 30, 101, 294
Bsa29I ATCGAT 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 217
BsaWI WCCGGW 2 cut(s) 197, 238
BsaXI ACNNNNNCTCC 2 cut(s) 220, 250
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse118I RCCGGY 1 cut(s) 197
Bse1I ACTGG 1 cut(s) 296
BseBI CCWGG 1 cut(s) 218
BseCI ATCGAT 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 217
BseGI GGATG 2 cut(s) 79, 178
BseLI CCNNNNNNNGG 1 cut(s) 188
BseNI ACTGG 1 cut(s) 296
BseYI CCCAGC 1 cut(s) 35
BshFI GGCC 1 cut(s) 295
BshNI GGYRCC 1 cut(s) 194
BshTI ACCGGT 1 cut(s) 197
BshVI ATCGAT 1 cut(s) 19
BsiSI CCGG 2 cut(s) 198, 239
BslI CCNNNNNNNGG 1 cut(s) 188
BsmI GAATGC 1 cut(s) 278
BsnI GGCC 1 cut(s) 295
Bsp143I GATC 2 cut(s) 20, 175
BspACI CCGC 1 cut(s) 112
BspANI GGCC 1 cut(s) 295
BspDI ATCGAT 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 196
BspT107I GGYRCC 1 cut(s) 194
BsrFI RCCGGY 1 cut(s) 197
BsrI ACTGG 1 cut(s) 296
BssAI RCCGGY 1 cut(s) 197
BssECI CCNNGG 1 cut(s) 217
BssMI GATC 2 cut(s) 20, 175
Bst2UI CCWGG 1 cut(s) 218
Bst4CI ACNGT 3 cut(s) 7, 128, 262
BstC8I GCNNGC 1 cut(s) 171
BstDEI CTNAG 1 cut(s) 99
BstF5I GGATG 2 cut(s) 79, 178
BstKTI GATC 2 cut(s) 23, 178
BstMBI GATC 2 cut(s) 20, 175
BstMWI GCNNNNNNNGC 3 cut(s) 41, 118, 311
BstNI CCWGG 1 cut(s) 218
BstSCI CCNGG 1 cut(s) 216
BstSFI CTRYAG 1 cut(s) 124
Bsu15I ATCGAT 1 cut(s) 19
BsuRI GGCC 1 cut(s) 295
BsuTUI ATCGAT 1 cut(s) 19
BtsCI GGATG 2 cut(s) 79, 178
BtsIMutI CAGTG 1 cut(s) 133
Cac8I GCNNGC 1 cut(s) 171
Cfr10I RCCGGY 1 cut(s) 197
ClaI ATCGAT 1 cut(s) 19
CspAI ACCGGT 1 cut(s) 197
CviAII CATG 1 cut(s) 250
DdeI CTNAG 1 cut(s) 99
DpnI GATC 2 cut(s) 22, 177
DpnII GATC 2 cut(s) 20, 175
EcoRII CCWGG 1 cut(s) 216
FaeI CATG 1 cut(s) 253
FaiI YATR 4 cut(s) 159, 225, 251, 303
FalI AAGNNNNNCTT 2 cut(s) 92, 124
FatI CATG 1 cut(s) 249
FbaI TGATCA 1 cut(s) 175
FokI GGATG 2 cut(s) 86, 165
GsaI CCCAGC 1 cut(s) 39
HaeIII GGCC 1 cut(s) 295
HapII CCGG 2 cut(s) 198, 239
Hin1II CATG 1 cut(s) 253
HindIII AAGCTT 2 cut(s) 209, 312
HpaII CCGG 2 cut(s) 198, 239
HphI GGTGA 1 cut(s) 212
Hpy188I TCNGA 1 cut(s) 191
HpyCH4III ACNGT 3 cut(s) 7, 128, 262
HpyCH4V TGCA 2 cut(s) 278, 305
HpyF10VI GCNNNNNNNGC 3 cut(s) 41, 118, 311
HpyF3I CTNAG 1 cut(s) 99
Hsp92II CATG 1 cut(s) 253
Ksp22I TGATCA 1 cut(s) 175
Kzo9I GATC 2 cut(s) 20, 175
LpnPI CCDG 9 cut(s) 21, 79, 183, 195, 203, 211, 230, 252, 277
MaeIII GTNAC 3 cut(s) 7, 226, 262
MalI GATC 2 cut(s) 22, 177
MboI GATC 2 cut(s) 20, 175
MboII GAAGA 1 cut(s) 15
MfeI CAATTG 1 cut(s) 93
MluCI AATT 1 cut(s) 93
MmeI TCCRAC 2 cut(s) 127, 169
MnlI CCTC 3 cut(s) 143, 185, 306
MseI TTAA 2 cut(s) 257, 319
MslI CAYNNNNRTG 1 cut(s) 126
MspI CCGG 2 cut(s) 198, 239
MspR9I CCNGG 1 cut(s) 218
MunI CAATTG 1 cut(s) 93
Mva1269I GAATGC 1 cut(s) 278
MvaI CCWGG 1 cut(s) 218
MwoI GCNNNNNNNGC 3 cut(s) 41, 118, 311
NdeII GATC 2 cut(s) 20, 175
NlaIII CATG 1 cut(s) 253
NlaIV GGNNCC 1 cut(s) 196
NmuCI GTSAC 2 cut(s) 7, 226
OliI CACNNNNGTG 1 cut(s) 126
PctI GAATGC 1 cut(s) 278
PinAI ACCGGT 1 cut(s) 197
Psp6I CCWGG 1 cut(s) 216
PspFI CCCAGC 1 cut(s) 35
PspGI CCWGG 1 cut(s) 216
PspN4I GGNNCC 1 cut(s) 196
RseI CAYNNNNRTG 1 cut(s) 126
SaqAI TTAA 2 cut(s) 257, 319
Sau3AI GATC 2 cut(s) 20, 175
ScrFI CCNGG 1 cut(s) 218
SetI ASST 9 cut(s) 33, 37, 46, 71, 110, 213, 269, 288, 316
SfcI CTRYAG 1 cut(s) 124
SgrAI CRCCGGYG 1 cut(s) 197
SmiMI CAYNNNNRTG 1 cut(s) 126
SmlI CTYRAG 3 cut(s) 45, 80, 309
SmoI CTYRAG 3 cut(s) 45, 80, 309
Sse9I AATT 1 cut(s) 93
SsiI CCGC 1 cut(s) 112
StyD4I CCNGG 1 cut(s) 216
TaaI ACNGT 3 cut(s) 7, 128, 262
TaqI TCGA 2 cut(s) 19, 134
TasI AATT 1 cut(s) 93
Tru1I TTAA 2 cut(s) 257, 319
Tru9I TTAA 2 cut(s) 257, 319
TscAI CASTG 1 cut(s) 133
TseFI GTSAC 2 cut(s) 7, 226
Tsp45I GTSAC 2 cut(s) 7, 226
TspRI CASTG 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.