Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001089.1

Orthogroup ID

OG0011256

Physical Location & Seq

Genomic Coordinates Reverse (-)

101681 .. 103603

Gene Structure 1923 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001089.1_g000026.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 711 bp

atggctaccatcgagaagaaggatttggagggcaaggttgggaacgagaaggcgctgaagcacctagggtttgtgaggatcgcggcaattcagacgctggtgtgcgtttcgaatctgtacgagtatgcgaagcagaactctgggcctctgagatcgacggttgggactgtggagggtgctgtcaccaccgtcgttggtccagtctatgagaagttcaagggcgtgcctgatgatcttcttgcttttcttgacaccaaggtagatgaagccacgggcaagtttaacaagcatgctcctcctttggctaagcaggttgcaagccaaggtcacagtttgatccagacgactttggagaagggccaaaaatttgtgaaggaggctcaaactgggggtcctcgctcagccattcattatgcagctacagaatctaagcagcttgtatttaaccaatctgtgaagctgtgggttgtacttgaccagtaccatccaatccacaaagtggcagagaaggctgcaccaacagctgctcacttgtccgagaaatacaaccacaccataagggacttgaccgtgaagggatataccatcttcggttatttgcccttggttccggttgatgatatttccaaagcagttgagcagggtaaggctgggaagaagggagatgcagctgtgcatgttgagcataaatctgattctgattccgactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HORMA NIF REF

Protein Analysis

236

Amino Acids

25.6

Weight (kDa)

8.72

Isoelectric Point (pI)

27.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011256)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G67360 AT1G67360
fragaria_vesca	FvH4_4g23790
malus_domestica	MD01G1161800.v1.1 MD08G1165600.v1.1 MD13G1118800.v1.1 MD16G1119000.v1.1
prunus_persica	Prupe.1G226000_v2.0.a1
pyrus_communis	pycom13g10370 pycom16g10190
rosa_chinensis	RchiOBHm_Chr4g0430281
rosa_laevigata	RLG00000006988
rosa_multiflora	Rmu_sc0001089.1_g000026
rosa_roxburghii	Rroxscaffold_5G00372080
rosa_rugosa	Rorug04G0242400
rosa_samantha	Rh4AG298800 Rh4BG305400 Rh4CG320900 Rh4DG302700
rosa_wichuraiana	Rw4G025910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	301
AccB7I	CCANNNNNTGG	1 cut(s)	499
AccII	CGCG	1 cut(s)	83
AciI	CCGC	1 cut(s)	83
AclWI	GGATC	2 cut(s)	86, 331
AcsI	RAATTY	1 cut(s)	365
AcuI	CTGAAG	1 cut(s)	77
AdeI	CACNNNGTG	1 cut(s)	499
AfaI	GTAC	3 cut(s)	119, 471, 482
AfiI	CCNNNNNNNGG	1 cut(s)	499
AgsI	TTSAA	1 cut(s)	217
AjuI	GAANNNNNNNTTGG	2 cut(s)	8, 40
AluBI	AGCT	5 cut(s)	419, 436, 460, 524, 671
AluI	AGCT	5 cut(s)	419, 436, 460, 524, 671
AlwI	GGATC	2 cut(s)	86, 331
AlwNI	CAGNNNCTG	1 cut(s)	97
AoxI	GGCC	2 cut(s)	143, 358
ApeKI	GCWGC	5 cut(s)	416, 433, 512, 524, 668
ApoI	RAATTY	1 cut(s)	365
ArsI	GACNNNNNNTTYG	2 cut(s)	376, 408
AspA2I	CCTAGG	1 cut(s)	64
AspLEI	GCGC	1 cut(s)	55
AspS9I	GGNCC	4 cut(s)	143, 197, 358, 392
AsuHPI	GGTGA	1 cut(s)	175
AsuII	TTCGAA	1 cut(s)	110
AvaII	GGWCC	2 cut(s)	197, 392
AvrII	CCTAGG	1 cut(s)	64
BbvI	GCAGC	5 cut(s)	428, 445, 499, 511, 680
BccI	CCATC	3 cut(s)	17, 492, 593
BfaI	CTAG	1 cut(s)	65
BfmI	CTRYAG	1 cut(s)	420
BfoI	RGCGCY	1 cut(s)	56
BfuAI	ACCTGC	1 cut(s)	301
BisI	GCNGC	6 cut(s)	84, 417, 434, 513, 525, 669
BlnI	CCTAGG	1 cut(s)	64
BlpI	GCTNAGC	2 cut(s)	306, 400
BlsI	GCNGC	6 cut(s)	85, 418, 435, 514, 526, 670
Bme18I	GGWCC	2 cut(s)	197, 392
BmgT120I	GGNCC	4 cut(s)	143, 197, 358, 392
BmiI	GGNNCC	2 cut(s)	393, 609
BmrI	ACTGGG	1 cut(s)	396
BmsI	GCATC	1 cut(s)	655
BmuI	ACTGGG	1 cut(s)	396
Bpu1102I	GCTNAGC	2 cut(s)	306, 400
Bpu14I	TTCGAA	1 cut(s)	110
BsaJI	CCNNGG	5 cut(s)	64, 255, 270, 322, 603
BsaWI	WCCGGW	1 cut(s)	610
Bsc4I	CCNNNNNNNGG	1 cut(s)	499
Bse1I	ACTGG	3 cut(s)	200, 391, 478
BseDI	CCNNGG	5 cut(s)	64, 255, 270, 322, 603
BseGI	GGATG	1 cut(s)	484
BseLI	CCNNNNNNNGG	1 cut(s)	499
BseMII	CTCAG	2 cut(s)	140, 414
BseNI	ACTGG	3 cut(s)	200, 391, 478
BseRI	GAGGAG	1 cut(s)	285
BseXI	GCAGC	5 cut(s)	428, 445, 499, 511, 680
BseYI	CCCAGC	1 cut(s)	650
BsgI	GTGCAG	1 cut(s)	498
Bsh1236I	CGCG	1 cut(s)	83
BshFI	GGCC	2 cut(s)	145, 360
BsiSI	CCGG	1 cut(s)	611
BslFI	GGGAC	2 cut(s)	178, 575
BslI	CCNNNNNNNGG	1 cut(s)	499
BsmFI	GGGAC	2 cut(s)	178, 575
BsnI	GGCC	2 cut(s)	145, 360
Bsp119I	TTCGAA	1 cut(s)	110
Bsp143I	GATC	4 cut(s)	78, 152, 232, 336
Bsp1720I	GCTNAGC	2 cut(s)	306, 400
BspACI	CCGC	1 cut(s)	83
BspANI	GGCC	2 cut(s)	145, 360
BspCNI	CTCAG	2 cut(s)	141, 413
BspFNI	CGCG	1 cut(s)	83
BspLI	GGNNCC	2 cut(s)	393, 609
BspMI	ACCTGC	1 cut(s)	301
BspPI	GGATC	2 cut(s)	86, 331
BspT104I	TTCGAA	1 cut(s)	110
BsrI	ACTGG	3 cut(s)	200, 391, 478
BssECI	CCNNGG	5 cut(s)	64, 255, 270, 322, 603
BssMI	GATC	4 cut(s)	78, 152, 232, 336
BssT1I	CCWWGG	4 cut(s)	64, 255, 322, 603
Bst4CI	ACNGT	5 cut(s)	160, 169, 190, 332, 571
BstBI	TTCGAA	1 cut(s)	110
BstC8I	GCNNGC	3 cut(s)	224, 291, 319
BstDEI	CTNAG	4 cut(s)	149, 306, 400, 429
BstDSI	CCRYGG	1 cut(s)	270
BstF5I	GGATG	1 cut(s)	484
BstFNI	CGCG	1 cut(s)	83
BstH2I	RGCGCY	1 cut(s)	56
BstHHI	GCGC	1 cut(s)	55
BstKTI	GATC	4 cut(s)	81, 155, 235, 339
BstMBI	GATC	4 cut(s)	78, 152, 232, 336
BstMWI	GCNNNNNNNGC	3 cut(s)	509, 521, 682
BstNSI	RCATGY	2 cut(s)	293, 680
BstSFI	CTRYAG	1 cut(s)	420
BstUI	CGCG	1 cut(s)	83
BstV1I	GCAGC	5 cut(s)	428, 445, 499, 511, 680
BsuRI	GGCC	2 cut(s)	145, 360
BtgI	CCRYGG	1 cut(s)	270
BtsCI	GGATG	1 cut(s)	484
BveI	ACCTGC	1 cut(s)	301
Cac8I	GCNNGC	3 cut(s)	224, 291, 319
CaiI	CAGNNNCTG	1 cut(s)	97
CfoI	GCGC	1 cut(s)	55
Cfr13I	GGNCC	4 cut(s)	143, 197, 358, 392
CseI	GACGC	1 cut(s)	103
Csp6I	GTAC	3 cut(s)	118, 470, 481
CspCI	CAANNNNNGTGG	2 cut(s)	175, 210
CviAII	CATG	2 cut(s)	290, 677
CviQI	GTAC	3 cut(s)	118, 470, 481
DdeI	CTNAG	4 cut(s)	149, 306, 400, 429
DpnI	GATC	4 cut(s)	80, 154, 234, 338
DpnII	GATC	4 cut(s)	78, 152, 232, 336
DraIII	CACNNNGTG	1 cut(s)	499
Eco130I	CCWWGG	4 cut(s)	64, 255, 322, 603
Eco47I	GGWCC	2 cut(s)	197, 392
Eco57I	CTGAAG	1 cut(s)	77
EcoO109I	RGGNCCY	1 cut(s)	392
EcoT14I	CCWWGG	4 cut(s)	64, 255, 322, 603
ErhI	CCWWGG	4 cut(s)	64, 255, 322, 603
FaeI	CATG	2 cut(s)	293, 680
FaiI	YATR	8 cut(s)	126, 207, 291, 414, 557, 582, 678, 687
FaqI	GGGAC	2 cut(s)	178, 575
FatI	CATG	2 cut(s)	289, 676
Fnu4HI	GCNGC	6 cut(s)	84, 417, 434, 513, 525, 669
FokI	GGATG	1 cut(s)	471
Fsp4HI	GCNGC	6 cut(s)	84, 417, 434, 513, 525, 669
FspBI	CTAG	1 cut(s)	65
GlaI	GCGC	1 cut(s)	54
GluI	GCNGC	6 cut(s)	84, 417, 434, 513, 525, 669
GsaI	CCCAGC	1 cut(s)	654
HaeII	RGCGCY	1 cut(s)	56
HaeIII	GGCC	2 cut(s)	145, 360
HapII	CCGG	1 cut(s)	611
HgaI	GACGC	1 cut(s)	103
HhaI	GCGC	1 cut(s)	55
Hin1II	CATG	2 cut(s)	293, 680
Hin6I	GCGC	1 cut(s)	53
HinP1I	GCGC	1 cut(s)	53
HinfI	GANTC	4 cut(s)	112, 425, 695, 701
HpaII	CCGG	1 cut(s)	611
HphI	GGTGA	1 cut(s)	175
Hpy188I	TCNGA	6 cut(s)	93, 150, 538, 694, 700, 706
Hpy188III	TCNNGA	3 cut(s)	13, 248, 340
Hpy99I	CGWCG	2 cut(s)	160, 194
HpyAV	CCTTC	7 cut(s)	13, 43, 349, 367, 502, 568, 652
HpyCH4III	ACNGT	5 cut(s)	160, 169, 190, 332, 571
HpyCH4V	TGCA	5 cut(s)	317, 416, 515, 668, 676
HpyF10VI	GCNNNNNNNGC	3 cut(s)	509, 521, 682
HpyF3I	CTNAG	4 cut(s)	149, 306, 400, 429
Hsp92II	CATG	2 cut(s)	293, 680
HspAI	GCGC	1 cut(s)	53
Kzo9I	GATC	4 cut(s)	78, 152, 232, 336
LmnI	GCTCC	1 cut(s)	298
Lsp1109I	GCAGC	5 cut(s)	428, 445, 499, 511, 680
LweI	GCATC	1 cut(s)	655
MaeI	CTAG	1 cut(s)	65
MaeIII	GTNAC	2 cut(s)	181, 326
MalI	GATC	4 cut(s)	80, 154, 234, 338
MboI	GATC	4 cut(s)	78, 152, 232, 336
MboII	GAAGA	4 cut(s)	28, 227, 580, 667
MluCI	AATT	2 cut(s)	87, 365
MnlI	CCTC	7 cut(s)	22, 69, 156, 166, 306, 370, 405
MseI	TTAA	2 cut(s)	282, 444
MspA1I	CMGCKG	2 cut(s)	524, 671
MspI	CCGG	1 cut(s)	611
MvnI	CGCG	1 cut(s)	83
MwoI	GCNNNNNNNGC	3 cut(s)	509, 521, 682
NdeII	GATC	4 cut(s)	78, 152, 232, 336
NlaIII	CATG	2 cut(s)	293, 680
NlaIV	GGNNCC	2 cut(s)	393, 609
NmuCI	GTSAC	2 cut(s)	181, 326
NspI	RCATGY	2 cut(s)	293, 680
NspV	TTCGAA	1 cut(s)	110
PaeI	GCATGC	1 cut(s)	293
PfeI	GAWTC	4 cut(s)	112, 425, 695, 701
PflMI	CCANNNNNTGG	1 cut(s)	499
PkrI	GCNGC	6 cut(s)	85, 418, 435, 514, 526, 670
PpuMI	RGGWCCY	1 cut(s)	392
Psp5II	RGGWCCY	1 cut(s)	392
PspFI	CCCAGC	1 cut(s)	650
PspN4I	GGNNCC	2 cut(s)	393, 609
PspPI	GGNCC	4 cut(s)	143, 197, 358, 392
PspPPI	RGGWCCY	1 cut(s)	392
PstNI	CAGNNNCTG	1 cut(s)	97
PvuII	CAGCTG	2 cut(s)	524, 671
RsaI	GTAC	3 cut(s)	119, 471, 482
RsaNI	GTAC	3 cut(s)	118, 470, 481
SaqAI	TTAA	2 cut(s)	282, 444
SatI	GCNGC	6 cut(s)	84, 417, 434, 513, 525, 669
Sau3AI	GATC	4 cut(s)	78, 152, 232, 336
Sau96I	GGNCC	4 cut(s)	143, 197, 358, 392
SfaNI	GCATC	1 cut(s)	655
SfcI	CTRYAG	1 cut(s)	420
SfuI	TTCGAA	1 cut(s)	110
SinI	GGWCC	2 cut(s)	197, 392
SphI	GCATGC	1 cut(s)	293
Sse9I	AATT	2 cut(s)	87, 365
SsiI	CCGC	1 cut(s)	83
SspMI	CTAG	1 cut(s)	65
StyI	CCWWGG	4 cut(s)	64, 255, 322, 603
TaaI	ACNGT	5 cut(s)	160, 169, 190, 332, 571
TaqI	TCGA	3 cut(s)	12, 110, 155
TasI	AATT	2 cut(s)	87, 365
TatI	WGTACW	1 cut(s)	469
TauI	GCSGC	1 cut(s)	86
TfiI	GAWTC	4 cut(s)	112, 425, 695, 701
Tru1I	TTAA	2 cut(s)	282, 444
Tru9I	TTAA	2 cut(s)	282, 444
TseFI	GTSAC	2 cut(s)	181, 326
TseI	GCWGC	5 cut(s)	416, 433, 512, 524, 668
Tsp45I	GTSAC	2 cut(s)	181, 326
TspDTI	ATGAA	2 cut(s)	279, 398
Van91I	CCANNNNNTGG	1 cut(s)	499
VpaK11BI	GGWCC	2 cut(s)	197, 392
XapI	RAATTY	1 cut(s)	365
XceI	RCATGY	2 cut(s)	293, 680
XmaJI	CCTAGG	1 cut(s)	64
XspI	CTAG	1 cut(s)	65

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.