Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001125.1

Orthogroup ID

OG0002775

Physical Location & Seq

Genomic Coordinates Reverse (-)

11689 .. 13039

Gene Structure 1351 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001125.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1248 bp

atgtgggtgcagcgtgcaaaaccatttaggcagataaaggccttgagtcagtcttttaagtctccatggattttttcgatatcgtcttcctactcagatactcctcacaagaagtcgaagcttgcccctctacaggttgcgcaagtgcccattggtacagtgattcatcttatgcagggtgaaattccttttgttgctgaaagccatgtttctaaagatttggatccatgggagcttccaggtactcctattgatgatgtaactggctctgaccagcaatctgcccctagtggtccaaatatggcagtggatactaggggtagctcatcatctcgacctgaaagaattattgaggaatcagctcacatgaaggaaatctcccaagttgaatccactgaggttcctactcaatctccaccttatttgtctgagatttgcacagaagacaagacagaggaagaagaacaaatgcaatacaacgttgctgagttaacagtaagaggtcaacgactagttattgctcgtggagcggaaggtggtctaggtagcgtgtctctcaaagtcccaaggaagttcaaaactgattcgttagatgctcaagtatctgatgatgatcagttgaccctcggtgctggtttgcctggttctgaagctgttctcatattagagctaaagagcattgctgatgtgagcctagtgggaatgccgaatgctggtaaaagtactctattaggggctatatctagggctaagcctgcagtgggccattacgccttcaccactcttagacccaatttggggaacctaaactttgatgacttttcactcacggttgctgatgttccgggactcataaagggtgcccatgagaatcgtggacttggacatgcattccttcgccatatagaacgcacaaaggttatagcttatgtggtggacttggctgctggattggatggtcgaaaaggaaccccaccttgggaacagcttagagatttggtcttagagcttgagtaccatcaagtgggtttatctgatcgaccatcactcatagtggcaaataaaatagatgaggaagggactgaaggcgtgcatgaagaactgaaaagaagggtgcaagatgttcctatattccctgtctgtgctattttgggggaaggaattcaagagctaaagattggtcttaggaaacttgtgaatggtgaaatgacagacagacttcaggttgataaaattatggttgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GTP1_OBG MMR_HSR1

Protein Analysis

415

Amino Acids

45.3

Weight (kDa)

5.28

Isoelectric Point (pI)

43.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002775)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G07615
fragaria_vesca	FvH4_3g36011 FvH4_3g36011 FvH4_3g36011 FvH4_3g36011 FvH4_3g36011 FvH4_3g36011
malus_domestica	MD03G1094400.v1.1 MD11G1109500.v1.1
prunus_persica	Prupe.6G078100_v2.0.a1 Prupe.6G078100_v2.0.a1 Prupe.6G078100_v2.0.a1 Prupe.6G078100_v2.0.a1 Prupe.6G078100_v2.0.a1 Prupe.6G078100_v2.0.a1 Prupe.6G078100_v2.0.a1
pyrus_communis	pycom03g07680
rosa_chinensis	RchiOBHm_Chr2g0137651 RchiOBHm_Chr5g0064441
rosa_laevigata	RLG00000019666 RLG00000035724
rosa_multiflora	Rmu_co8264625.1_g000001 Rmu_sc0000765.1_g000032 Rmu_sc0001125.1_g000005 Rmu_sc0006937.1_g000009
rosa_roxburghii	Rroxscaffold_1G00016560 Rroxscaffold_2G00106970
rosa_rugosa	Rorug02G0343800 Rorug05G0365000
rosa_samantha	Rh2AG391600 Rh2BG399100 Rh2CG378500 Rh2DG414100 Rh5AG423300 Rh5BG438800 Rh5CG461500 Rh5DG452100
rosa_wichuraiana	Rw2G032080 Rw5G039790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	141
AccB1I	GGYRCC	1 cut(s)	860
AccB7I	CCANNNNNTGG	1 cut(s)	1024
AccBSI	CCGCTC	1 cut(s)	530
AciI	CCGC	1 cut(s)	530
AclI	AACGTT	1 cut(s)	480
AclWI	GGATC	2 cut(s)	218, 231
AcsI	RAATTY	2 cut(s)	183, 1161
AcuI	CTGAAG	3 cut(s)	669, 1104, 1205
AfaI	GTAC	4 cut(s)	157, 244, 724, 1016
AfiI	CCNNNNNNNGG	8 cut(s)	133, 713, 761, 797, 798, 978, 979, 1024
AgsI	TTSAA	3 cut(s)	389, 577, 1166
AhlI	ACTAGT	1 cut(s)	511
AjnI	CCWGG	2 cut(s)	238, 640
AjuI	GAANNNNNNNTTGG	2 cut(s)	961, 993
Alw26I	GTCTC	2 cut(s)	66, 558
AlwI	GGATC	2 cut(s)	218, 231
AoxI	GGCC	2 cut(s)	39, 763
ApeKI	GCWGC	2 cut(s)	10, 944
ApoI	RAATTY	2 cut(s)	183, 1161
Asp700I	GAANNNNTTC	2 cut(s)	654, 1161
AspLEI	GCGC	1 cut(s)	142
AspS9I	GGNCC	2 cut(s)	293, 763
AsuC2I	CCSGG	1 cut(s)	846
AsuHPI	GGTGA	3 cut(s)	191, 769, 1214
AvaII	GGWCC	1 cut(s)	293
BaeGI	GKGCMC	2 cut(s)	150, 865
BamHI	GGATCC	1 cut(s)	223
BanI	GGYRCC	1 cut(s)	860
BauI	CACGAG	1 cut(s)	522
BbsI	GAAGAC	2 cut(s)	78, 450
BbvI	GCAGC	2 cut(s)	22, 931
BccI	CCATC	3 cut(s)	950, 1026, 1051
BciT130I	CCWGG	2 cut(s)	240, 642
BciVI	GTATCC	1 cut(s)	304
BclI	TGATCA	1 cut(s)	613
BcnI	CCSGG	1 cut(s)	846
BcoDI	GTCTC	2 cut(s)	66, 558
BcuI	ACTAGT	1 cut(s)	511
BfaI	CTAG	6 cut(s)	288, 315, 512, 542, 695, 744
BfmI	CTRYAG	2 cut(s)	131, 756
BfuI	GTATCC	1 cut(s)	304
BisI	GCNGC	2 cut(s)	11, 945
BlpI	GCTNAGC	1 cut(s)	750
BlsI	GCNGC	2 cut(s)	12, 946
BmcAI	AGTACT	1 cut(s)	724
Bme1390I	CCNGG	3 cut(s)	240, 642, 846
Bme18I	GGWCC	1 cut(s)	293
BmgT120I	GGNCC	2 cut(s)	293, 763
BmiI	GGNNCC	5 cut(s)	225, 402, 803, 862, 970
BmrFI	CCNGG	3 cut(s)	240, 642, 846
BmsI	GCATC	1 cut(s)	583
BpiI	GAAGAC	2 cut(s)	78, 450
Bpu1102I	GCTNAGC	1 cut(s)	750
BpuEI	CTTGAG	3 cut(s)	64, 582, 1031
BpuMI	CCSGG	1 cut(s)	846
BsaBI	GATNNNNATC	2 cut(s)	222, 612
BsaJI	CCNNGG	5 cut(s)	65, 227, 566, 625, 977
BsaXI	ACNNNNNCTCC	2 cut(s)	397, 427
Bsc4I	CCNNNNNNNGG	8 cut(s)	133, 713, 761, 797, 798, 978, 979, 1024
Bse1I	ACTGG	1 cut(s)	268
Bse3DI	GCAATG	1 cut(s)	678
Bse8I	GATNNNNATC	2 cut(s)	222, 612
BseBI	CCWGG	2 cut(s)	240, 642
BseDI	CCNNGG	5 cut(s)	65, 227, 566, 625, 977
BseGI	GGATG	1 cut(s)	961
BseJI	GATNNNNATC	2 cut(s)	222, 612
BseLI	CCNNNNNNNGG	8 cut(s)	133, 713, 761, 797, 798, 978, 979, 1024
BseMI	GCAATG	1 cut(s)	678
BseMII	CTCAG	4 cut(s)	108, 387, 420, 477
BseNI	ACTGG	1 cut(s)	268
BseRI	GAGGAG	1 cut(s)	93
BseSI	GKGCMC	2 cut(s)	150, 865
BseXI	GCAGC	2 cut(s)	22, 931
BsgI	GTGCAG	1 cut(s)	29
BshFI	GGCC	2 cut(s)	41, 765
BshNI	GGYRCC	1 cut(s)	860
BsiSI	CCGG	1 cut(s)	845
BslFI	GGGAC	3 cut(s)	548, 861, 1093
BslI	CCNNNNNNNGG	8 cut(s)	133, 713, 761, 797, 798, 978, 979, 1024
BsmAI	GTCTC	2 cut(s)	66, 558
BsmFI	GGGAC	3 cut(s)	548, 861, 1093
BsmI	GAATGC	3 cut(s)	708, 715, 890
BsnI	GGCC	2 cut(s)	41, 765
Bsp1286I	GDGCHC	2 cut(s)	150, 865
Bsp143I	GATC	3 cut(s)	223, 613, 1036
Bsp1720I	GCTNAGC	1 cut(s)	750
Bsp19I	CCATGG	2 cut(s)	65, 227
BspACI	CCGC	1 cut(s)	530
BspANI	GGCC	2 cut(s)	41, 765
BspCNI	CTCAG	4 cut(s)	107, 388, 421, 478
BspLI	GGNNCC	5 cut(s)	225, 402, 803, 862, 970
BspMAI	CTGCAG	1 cut(s)	760
BspPI	GGATC	2 cut(s)	218, 231
BspT107I	GGYRCC	1 cut(s)	860
BsrBI	CCGCTC	1 cut(s)	530
BsrDI	GCAATG	1 cut(s)	678
BsrI	ACTGG	1 cut(s)	268
BssECI	CCNNGG	5 cut(s)	65, 227, 566, 625, 977
BssMI	GATC	3 cut(s)	223, 613, 1036
BssSI	CACGAG	1 cut(s)	522
BssT1I	CCWWGG	4 cut(s)	65, 227, 566, 977
Bst2BI	CACGAG	1 cut(s)	522
Bst2UI	CCWGG	2 cut(s)	240, 642
Bst4CI	ACNGT	3 cut(s)	160, 496, 832
BstC8I	GCNNGC	4 cut(s)	15, 123, 756, 1091
BstDEI	CTNAG	9 cut(s)	94, 396, 429, 486, 750, 785, 989, 1003, 1184
BstDSI	CCRYGG	2 cut(s)	65, 227
BstF5I	GGATG	1 cut(s)	961
BstHHI	GCGC	1 cut(s)	142
BstKTI	GATC	3 cut(s)	226, 616, 1039
BstMAI	GTCTC	2 cut(s)	66, 558
BstMBI	GATC	3 cut(s)	223, 613, 1036
BstMWI	GCNNNNNNNGC	2 cut(s)	527, 755
BstNI	CCWGG	2 cut(s)	240, 642
BstNSI	RCATGY	1 cut(s)	890
BstSCI	CCNGG	3 cut(s)	238, 640, 844
BstSFI	CTRYAG	2 cut(s)	131, 756
BstSLI	GKGCMC	2 cut(s)	150, 865
BstV1I	GCAGC	2 cut(s)	22, 931
BstV2I	GAAGAC	2 cut(s)	78, 450
BstX2I	RGATCY	1 cut(s)	223
BstYI	RGATCY	1 cut(s)	223
BsuI	GTATCC	1 cut(s)	304
BsuRI	GGCC	2 cut(s)	41, 765
BtgI	CCRYGG	2 cut(s)	65, 227
BtsCI	GGATG	1 cut(s)	961
BtsI	GCAGTG	2 cut(s)	312, 765
BtsIMutI	CAGTG	4 cut(s)	165, 312, 393, 765
Cac8I	GCNNGC	4 cut(s)	15, 123, 756, 1091
CfoI	GCGC	1 cut(s)	142
Cfr13I	GGNCC	2 cut(s)	293, 763
Csp6I	GTAC	4 cut(s)	156, 243, 723, 1015
CspCI	CAANNNNNGTGG	2 cut(s)	405, 440
CviAII	CATG	7 cut(s)	66, 206, 228, 367, 866, 887, 1094
CviQI	GTAC	4 cut(s)	156, 243, 723, 1015
DdeI	CTNAG	9 cut(s)	94, 396, 429, 486, 750, 785, 989, 1003, 1184
DpnI	GATC	3 cut(s)	225, 615, 1038
DpnII	GATC	3 cut(s)	223, 613, 1036
Eco130I	CCWWGG	4 cut(s)	65, 227, 566, 977
Eco147I	AGGCCT	1 cut(s)	41
Eco32I	GATATC	1 cut(s)	81
Eco47I	GGWCC	1 cut(s)	293
Eco57I	CTGAAG	3 cut(s)	669, 1104, 1205
EcoRI	GAATTC	1 cut(s)	1161
EcoRII	CCWGG	2 cut(s)	238, 640
EcoRV	GATATC	1 cut(s)	81
EcoT14I	CCWWGG	4 cut(s)	65, 227, 566, 977
EcoT22I	ATGCAT	1 cut(s)	892
ErhI	CCWWGG	4 cut(s)	65, 227, 566, 977
FaeI	CATG	7 cut(s)	69, 209, 231, 370, 869, 890, 1097
FaqI	GGGAC	3 cut(s)	548, 861, 1093
FatI	CATG	7 cut(s)	65, 205, 227, 366, 865, 886, 1093
FbaI	TGATCA	1 cut(s)	613
Fnu4HI	GCNGC	2 cut(s)	11, 945
FokI	GGATG	1 cut(s)	968
Fsp4HI	GCNGC	2 cut(s)	11, 945
FspBI	CTAG	6 cut(s)	288, 315, 512, 542, 695, 744
FspI	TGCGCA	1 cut(s)	141
GlaI	GCGC	1 cut(s)	141
GluI	GCNGC	2 cut(s)	11, 945
HaeIII	GGCC	2 cut(s)	41, 765
HapII	CCGG	1 cut(s)	845
HhaI	GCGC	1 cut(s)	142
Hin1II	CATG	7 cut(s)	69, 209, 231, 370, 869, 890, 1097
Hin6I	GCGC	1 cut(s)	140
HinP1I	GCGC	1 cut(s)	140
HincII	GTYRAC	3 cut(s)	492, 506, 621
HindII	GTYRAC	3 cut(s)	492, 506, 621
HindIII	AAGCTT	1 cut(s)	119
HinfI	GANTC	7 cut(s)	46, 163, 356, 389, 584, 849, 871
HpaI	GTTAAC	1 cut(s)	492
HpaII	CCGG	1 cut(s)	845
HphI	GGTGA	3 cut(s)	191, 769, 1214
Hpy166II	GTNNAC	5 cut(s)	492, 506, 621, 878, 937
Hpy188I	TCNGA	6 cut(s)	97, 271, 430, 607, 649, 1036
Hpy188III	TCNNGA	2 cut(s)	333, 1166
Hpy8I	GTNNAC	5 cut(s)	492, 506, 621, 878, 937
HpyAV	CCTTC	8 cut(s)	364, 527, 784, 905, 1070, 1079, 1104, 1151
HpyCH4III	ACNGT	3 cut(s)	160, 496, 832
HpyCH4IV	ACGT	1 cut(s)	480
HpyCH4V	TGCA	9 cut(s)	10, 17, 175, 438, 472, 758, 890, 1093, 1117
HpyF10VI	GCNNNNNNNGC	2 cut(s)	527, 755
HpyF3I	CTNAG	9 cut(s)	94, 396, 429, 486, 750, 785, 989, 1003, 1184
HpySE526I	ACGT	1 cut(s)	480
Hsp92II	CATG	7 cut(s)	69, 209, 231, 370, 869, 890, 1097
HspAI	GCGC	1 cut(s)	140
Ksp22I	TGATCA	1 cut(s)	613
KspAI	GTTAAC	1 cut(s)	492
Kzo9I	GATC	3 cut(s)	223, 613, 1036
LmnI	GCTCC	2 cut(s)	232, 527
Lsp1109I	GCAGC	2 cut(s)	22, 931
LweI	GCATC	1 cut(s)	583
MaeI	CTAG	6 cut(s)	288, 315, 512, 542, 695, 744
MaeII	ACGT	1 cut(s)	480
MaeIII	GTNAC	1 cut(s)	259
MalI	GATC	3 cut(s)	225, 615, 1038
MbiI	CCGCTC	1 cut(s)	530
MboI	GATC	3 cut(s)	223, 613, 1036
MboII	GAAGA	5 cut(s)	78, 455, 470, 473, 1109
MflI	RGATCY	1 cut(s)	223
MhlI	GDGCHC	2 cut(s)	150, 865
MluCI	AATT	5 cut(s)	183, 345, 793, 1161, 1233
MlyI	GAGTC	2 cut(s)	55, 843
MnlI	CCTC	8 cut(s)	114, 138, 346, 391, 448, 494, 635, 1066
Mph1103I	ATGCAT	1 cut(s)	892
MroXI	GAANNNNTTC	2 cut(s)	654, 1161
MseI	TTAA	3 cut(s)	57, 491, 1246
MspI	CCGG	1 cut(s)	845
MspR9I	CCNGG	3 cut(s)	240, 642, 846
Mva1269I	GAATGC	3 cut(s)	708, 715, 890
MvaI	CCWGG	2 cut(s)	240, 642
MwoI	GCNNNNNNNGC	2 cut(s)	527, 755
NciI	CCSGG	1 cut(s)	846
NcoI	CCATGG	2 cut(s)	65, 227
NdeII	GATC	3 cut(s)	223, 613, 1036
NlaIII	CATG	7 cut(s)	69, 209, 231, 370, 869, 890, 1097
NlaIV	GGNNCC	5 cut(s)	225, 402, 803, 862, 970
NsbI	TGCGCA	1 cut(s)	141
NsiI	ATGCAT	1 cut(s)	892
NspI	RCATGY	1 cut(s)	890
PceI	AGGCCT	1 cut(s)	41
PctI	GAATGC	3 cut(s)	708, 715, 890
PdmI	GAANNNNTTC	2 cut(s)	654, 1161
PfeI	GAWTC	5 cut(s)	163, 356, 389, 584, 871
PflMI	CCANNNNNTGG	1 cut(s)	1024
PfoI	TCCNGGA	1 cut(s)	844
PkrI	GCNGC	2 cut(s)	12, 946
PleI	GAGTC	2 cut(s)	54, 843
PpsI	GAGTC	2 cut(s)	54, 843
Psp1406I	AACGTT	1 cut(s)	480
Psp6I	CCWGG	2 cut(s)	238, 640
PspGI	CCWGG	2 cut(s)	238, 640
PspN4I	GGNNCC	5 cut(s)	225, 402, 803, 862, 970
PspPI	GGNCC	2 cut(s)	293, 763
PstI	CTGCAG	1 cut(s)	760
PsuI	RGATCY	1 cut(s)	223
RsaI	GTAC	4 cut(s)	157, 244, 724, 1016
RsaNI	GTAC	4 cut(s)	156, 243, 723, 1015
SaqAI	TTAA	3 cut(s)	57, 491, 1246
SatI	GCNGC	2 cut(s)	11, 945
Sau3AI	GATC	3 cut(s)	223, 613, 1036
Sau96I	GGNCC	2 cut(s)	293, 763
ScaI	AGTACT	1 cut(s)	724
SchI	GAGTC	2 cut(s)	55, 843
ScrFI	CCNGG	3 cut(s)	240, 642, 846
SduI	GDGCHC	2 cut(s)	150, 865
SfaNI	GCATC	1 cut(s)	583
SfcI	CTRYAG	2 cut(s)	131, 756
SinI	GGWCC	1 cut(s)	293
SmlI	CTYRAG	3 cut(s)	43, 597, 1010
SmoI	CTYRAG	3 cut(s)	43, 597, 1010
SpeI	ACTAGT	1 cut(s)	511
Sse9I	AATT	5 cut(s)	183, 345, 793, 1161, 1233
SseBI	AGGCCT	1 cut(s)	41
SsiI	CCGC	1 cut(s)	530
SspMI	CTAG	6 cut(s)	288, 315, 512, 542, 695, 744
StuI	AGGCCT	1 cut(s)	41
StyD4I	CCNGG	3 cut(s)	238, 640, 844
StyI	CCWWGG	4 cut(s)	65, 227, 566, 977
TaaI	ACNGT	3 cut(s)	160, 496, 832
TaiI	ACGT	1 cut(s)	483
TaqI	TCGA	5 cut(s)	77, 116, 334, 961, 1039
TasI	AATT	5 cut(s)	183, 345, 793, 1161, 1233
TatI	WGTACW	1 cut(s)	722
TfiI	GAWTC	5 cut(s)	163, 356, 389, 584, 871
Tru1I	TTAA	3 cut(s)	57, 491, 1246
Tru9I	TTAA	3 cut(s)	57, 491, 1246
TscAI	CASTG	4 cut(s)	165, 312, 400, 765
TseI	GCWGC	2 cut(s)	10, 944
TspDTI	ATGAA	3 cut(s)	155, 383, 1110
TspRI	CASTG	4 cut(s)	165, 312, 400, 765
Van91I	CCANNNNNTGG	1 cut(s)	1024
VpaK11BI	GGWCC	1 cut(s)	293
XapI	RAATTY	2 cut(s)	183, 1161
XceI	RCATGY	1 cut(s)	890
XcmI	CCANNNNNNNNNTGG	1 cut(s)	872
XmnI	GAANNNNTTC	2 cut(s)	654, 1161
XspI	CTAG	6 cut(s)	288, 315, 512, 542, 695, 744
ZrmI	AGTACT	1 cut(s)	724
Zsp2I	ATGCAT	1 cut(s)	892

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.