Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001196.1

Orthogroup ID

OG0008386

Physical Location & Seq

Genomic Coordinates Forward (+)

30311 .. 32655

Gene Structure 2345 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001196.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 609 bp

atgggcaagaatcaagcttacaaggctatgcagagagccaggctgggatccagctccgctggccccgatgaggtcgaagacggcatggtggatggttcatttcattcaccagagtggcatgctgctcgtttggctagccttaaaacttctcatacaattacctgggaggagtataaaaagaagcaaaaggaagatgaactgagaaaaggggaactggaaaaagataccgatagaatgatgagagaatacagggctcaactggatgccgaaagggctcgcaagcttgccaatggaagaaaccactctagtagcaagtctgatcgcaaaaaagataagaaggataaagatttaaagaaacgcagcagcagcagcagcagaaagagaaagcattcaagaaggagatcctcagagtctagctcctcgacttcatcgtcagattcttccagtagtgaagaagatgacagagaatcaagaagatccaagtccaggtctaagagaacaaaaaaggaaaagaagcacaggtcaagaaccaagcactctagcagtgatgatgacgaggctgatggccctgttccactttcccgattctttggaagtgtcaagagctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

202

Amino Acids

23.11

Weight (kDa)

10.07

Isoelectric Point (pI)

66.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008386)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43795 AT2G43795 AT3G59800 AT3G59800
fragaria_vesca	FvH4_1g00470
malus_domestica	MD02G1003900.v1.1 MD15G1147200.v1.1
prunus_persica	Prupe.7G267400_v2.0.a1 Prupe.7G267400_v2.0.a1
pyrus_communis	pycom02g00240 pycom15g13210
rosa_chinensis	RchiOBHm_Chr2g0084981
rosa_laevigata	RLG00000015653
rosa_multiflora	Rmu_sc0001196.1_g000004 Rmu_sc0008647.1_g000019
rosa_roxburghii	Rroxscaffold_2G00155660
rosa_rugosa	Rorug01G0457400 Rorug01G0457500
rosa_samantha	Rh2AG005400 Rh2BG006400 Rh2CG006900 Rh2DG006800
rosa_wichuraiana	Rw2G000510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	430
AciI	CCGC	1 cut(s)	57
AclWI	GGATC	4 cut(s)	42, 55, 396, 471
AfiI	CCNNNNNNNGG	2 cut(s)	70, 486
AgsI	TTSAA	1 cut(s)	393
AjnI	CCWGG	3 cut(s)	38, 161, 485
AleI	CACNNNNGTG	1 cut(s)	112
AluBI	AGCT	5 cut(s)	17, 54, 283, 417, 606
AluI	AGCT	5 cut(s)	17, 54, 283, 417, 606
AlwI	GGATC	4 cut(s)	42, 55, 396, 471
AoxI	GGCC	2 cut(s)	61, 565
ApeKI	GCWGC	6 cut(s)	122, 360, 363, 366, 369, 372
Asp700I	GAANNNNTTC	1 cut(s)	388
AspS9I	GGNCC	2 cut(s)	62, 566
AsuHPI	GGTGA	1 cut(s)	99
AsuNHI	GCTAGC	1 cut(s)	134
BamHI	GGATCC	1 cut(s)	47
BanII	GRGCYC	2 cut(s)	256, 277
BbsI	GAAGAC	1 cut(s)	84
BbvI	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
BccI	CCATC	2 cut(s)	86, 557
BceAI	ACGGC	1 cut(s)	97
BcgI	CGANNNNNNTGC	2 cut(s)	107, 141
BciT130I	CCWGG	3 cut(s)	40, 163, 487
BfaI	CTAG	5 cut(s)	135, 306, 414, 540, 607
BglI	GCCNNNNNGGC	1 cut(s)	272
BisI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
BlsI	GCNGC	6 cut(s)	124, 362, 365, 368, 371, 374
Bme1390I	CCNGG	3 cut(s)	40, 163, 487
BmgT120I	GGNCC	2 cut(s)	62, 566
BmiI	GGNNCC	2 cut(s)	49, 64
BmrFI	CCNGG	3 cut(s)	40, 163, 487
BmsI	GCATC	1 cut(s)	253
BmtI	GCTAGC	1 cut(s)	138
BpiI	GAAGAC	1 cut(s)	84
BplI	GAGNNNNNCTC	2 cut(s)	401, 433
BsaJI	CCNNGG	1 cut(s)	162
Bsc4I	CCNNNNNNNGG	2 cut(s)	70, 486
Bse1I	ACTGG	3 cut(s)	219, 264, 444
BseBI	CCWGG	3 cut(s)	40, 163, 487
BseDI	CCNNGG	1 cut(s)	162
BseGI	GGATG	2 cut(s)	97, 268
BseLI	CCNNNNNNNGG	2 cut(s)	70, 486
BseMII	CTCAG	2 cut(s)	191, 420
BseNI	ACTGG	3 cut(s)	219, 264, 444
BseRI	GAGGAG	2 cut(s)	182, 409
BseXI	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
BseYI	CCCAGC	1 cut(s)	43
BshFI	GGCC	2 cut(s)	63, 567
BslI	CCNNNNNNNGG	2 cut(s)	70, 486
BsmI	GAATGC	1 cut(s)	388
BsnI	GGCC	2 cut(s)	63, 567
Bsp1286I	GDGCHC	2 cut(s)	256, 277
Bsp143I	GATC	4 cut(s)	47, 319, 401, 476
BspACI	CCGC	1 cut(s)	57
BspANI	GGCC	2 cut(s)	63, 567
BspCNI	CTCAG	2 cut(s)	192, 419
BspLI	GGNNCC	2 cut(s)	49, 64
BspOI	GCTAGC	1 cut(s)	138
BspPI	GGATC	4 cut(s)	42, 55, 396, 471
BsrI	ACTGG	3 cut(s)	219, 264, 444
BssECI	CCNNGG	1 cut(s)	162
BssMI	GATC	4 cut(s)	47, 319, 401, 476
Bst2UI	CCWGG	3 cut(s)	40, 163, 487
BstC8I	GCNNGC	6 cut(s)	61, 120, 136, 277, 281, 285
BstDEI	CTNAG	3 cut(s)	200, 406, 492
BstF5I	GGATG	2 cut(s)	97, 268
BstKTI	GATC	4 cut(s)	50, 322, 404, 479
BstMBI	GATC	4 cut(s)	47, 319, 401, 476
BstMWI	GCNNNNNNNGC	7 cut(s)	23, 60, 131, 272, 366, 369, 372
BstNI	CCWGG	3 cut(s)	40, 163, 487
BstNSI	RCATGY	1 cut(s)	122
BstSCI	CCNGG	3 cut(s)	38, 161, 485
BstV1I	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
BstV2I	GAAGAC	1 cut(s)	84
BstX2I	RGATCY	3 cut(s)	47, 401, 476
BstYI	RGATCY	3 cut(s)	47, 401, 476
BsuRI	GGCC	2 cut(s)	63, 567
BtsCI	GGATG	2 cut(s)	97, 268
BtsI	GCAGTG	1 cut(s)	550
BtsIMutI	CAGTG	1 cut(s)	550
Cac8I	GCNNGC	6 cut(s)	61, 120, 136, 277, 281, 285
Cfr13I	GGNCC	2 cut(s)	62, 566
CviAII	CATG	2 cut(s)	85, 119
DdeI	CTNAG	3 cut(s)	200, 406, 492
DpnI	GATC	4 cut(s)	49, 321, 403, 478
DpnII	GATC	4 cut(s)	47, 319, 401, 476
DraI	TTTAAA	1 cut(s)	351
DrdI	GACNNNNNNGTC	1 cut(s)	430
DseDI	GACNNNNNNGTC	1 cut(s)	430
Eco24I	GRGCYC	2 cut(s)	256, 277
EcoRII	CCWGG	3 cut(s)	38, 161, 485
EcoT38I	GRGCYC	2 cut(s)	256, 277
FaeI	CATG	2 cut(s)	88, 122
FaiI	YATR	5 cut(s)	29, 86, 120, 153, 174
FatI	CATG	2 cut(s)	84, 118
Fnu4HI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
FokI	GGATG	2 cut(s)	104, 275
FriOI	GRGCYC	2 cut(s)	256, 277
Fsp4HI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
FspBI	CTAG	5 cut(s)	135, 306, 414, 540, 607
GluI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
GsaI	CCCAGC	1 cut(s)	47
HaeIII	GGCC	2 cut(s)	63, 567
Hin1II	CATG	2 cut(s)	88, 122
HindIII	AAGCTT	2 cut(s)	15, 281
HinfI	GANTC	5 cut(s)	10, 410, 437, 467, 585
HphI	GGTGA	1 cut(s)	99
Hpy188I	TCNGA	3 cut(s)	319, 409, 436
Hpy188III	TCNNGA	5 cut(s)	393, 471, 525, 582, 601
HpyAV	CCTTC	2 cut(s)	331, 390
HpyCH4V	TGCA	1 cut(s)	31
HpyF10VI	GCNNNNNNNGC	7 cut(s)	23, 60, 131, 272, 366, 369, 372
HpyF3I	CTNAG	3 cut(s)	200, 406, 492
Hsp92II	CATG	2 cut(s)	88, 122
Kzo9I	GATC	4 cut(s)	47, 319, 401, 476
LmnI	GCTCC	2 cut(s)	59, 422
Lsp1109I	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
LweI	GCATC	1 cut(s)	253
MaeI	CTAG	5 cut(s)	135, 306, 414, 540, 607
MalI	GATC	4 cut(s)	49, 321, 403, 478
MboI	GATC	4 cut(s)	47, 319, 401, 476
MboII	GAAGA	7 cut(s)	89, 203, 306, 432, 464, 467, 486
MflI	RGATCY	3 cut(s)	47, 401, 476
MhlI	GDGCHC	2 cut(s)	256, 277
MluCI	AATT	1 cut(s)	156
MlyI	GAGTC	1 cut(s)	419
MnlI	CCTC	5 cut(s)	64, 160, 415, 430, 550
MroXI	GAANNNNTTC	1 cut(s)	388
MseI	TTAA	2 cut(s)	141, 350
MslI	CAYNNNNRTG	1 cut(s)	112
MspA1I	CMGCKG	1 cut(s)	59
MspR9I	CCNGG	3 cut(s)	40, 163, 487
Mva1269I	GAATGC	1 cut(s)	388
MvaI	CCWGG	3 cut(s)	40, 163, 487
MwoI	GCNNNNNNNGC	7 cut(s)	23, 60, 131, 272, 366, 369, 372
NdeII	GATC	4 cut(s)	47, 319, 401, 476
NheI	GCTAGC	1 cut(s)	134
NlaIII	CATG	2 cut(s)	88, 122
NlaIV	GGNNCC	2 cut(s)	49, 64
NspI	RCATGY	1 cut(s)	122
OliI	CACNNNNGTG	1 cut(s)	112
PaeI	GCATGC	1 cut(s)	122
PcsI	WCGNNNNNNNCGW	1 cut(s)	428
PctI	GAATGC	1 cut(s)	388
PdmI	GAANNNNTTC	1 cut(s)	388
PfeI	GAWTC	4 cut(s)	10, 437, 467, 585
PkrI	GCNGC	6 cut(s)	124, 362, 365, 368, 371, 374
PleI	GAGTC	1 cut(s)	418
PpsI	GAGTC	1 cut(s)	418
Psp6I	CCWGG	3 cut(s)	38, 161, 485
PspFI	CCCAGC	1 cut(s)	43
PspGI	CCWGG	3 cut(s)	38, 161, 485
PspN4I	GGNNCC	2 cut(s)	49, 64
PspPI	GGNCC	2 cut(s)	62, 566
PsuI	RGATCY	3 cut(s)	47, 401, 476
RseI	CAYNNNNRTG	1 cut(s)	112
SaqAI	TTAA	2 cut(s)	141, 350
SatI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
Sau3AI	GATC	4 cut(s)	47, 319, 401, 476
Sau96I	GGNCC	2 cut(s)	62, 566
SchI	GAGTC	1 cut(s)	419
ScrFI	CCNGG	3 cut(s)	40, 163, 487
SduI	GDGCHC	2 cut(s)	256, 277
SetI	ASST	9 cut(s)	19, 56, 75, 164, 285, 419, 491, 524, 608
SfaNI	GCATC	1 cut(s)	253
SmiMI	CAYNNNNRTG	1 cut(s)	112
SphI	GCATGC	1 cut(s)	122
Sse9I	AATT	1 cut(s)	156
SsiI	CCGC	1 cut(s)	57
SspMI	CTAG	5 cut(s)	135, 306, 414, 540, 607
StyD4I	CCNGG	3 cut(s)	38, 161, 485
TaqI	TCGA	2 cut(s)	75, 422
TasI	AATT	1 cut(s)	156
TfiI	GAWTC	4 cut(s)	10, 437, 467, 585
Tru1I	TTAA	2 cut(s)	141, 350
Tru9I	TTAA	2 cut(s)	141, 350
TscAI	CASTG	1 cut(s)	550
TseI	GCWGC	6 cut(s)	122, 360, 363, 366, 369, 372
TspDTI	ATGAA	4 cut(s)	87, 92, 210, 417
TspRI	CASTG	1 cut(s)	550
XceI	RCATGY	1 cut(s)	122
XmnI	GAANNNNTTC	1 cut(s)	388
XspI	CTAG	5 cut(s)	135, 306, 414, 540, 607

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.