Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2D

Orthogroup ID

OG0008386

Physical Location & Seq

Genomic Coordinates Forward (+)

417508 .. 423510

Gene Structure 6003 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2DG006800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 486 bp

ATGGGCAAGAATCAAGCTTACAAGGCTATGCAGAGAGCCAGGCTGGGATCCAGCTCCGCTGGCCCCGATGAGGTCGAAGACGGCATGGTGGATGGTTCATTTCATTCACCAGAGTGGCATGCTGCTCGTTTGGCTAGCCTTAAAACTTCTCATACAATTACCTGGGAGGAGTATAAAAAGAAGCAAAAGGAAGATGAACTGAGAAAAGGGGAACTGGAAAAAGATACCGATAGAATGATGAGAGAATACAGGGCTCAACTGGATGCCGAAAGGGCTCGCAAGCTTGCCAATGGAAGAAACCACTCTAGTAGCAAGTCTGATCGCAAAAAAGATAAGAAGGATAAAGATTTAAAGAAACGCAGCAGCAGCAGCAGCAGAAAGAGAAAGGTGCTTATTTCCTACTATTTGCTGTTGTGTCACTGGTGTTTGTGGTGGTGGATTCTGTGTGTTTCAATACTGCATTGCACTATAAAGAGAAAAGCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

161

Amino Acids

18.87

Weight (kDa)

9.8

Isoelectric Point (pI)

37.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008386)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43795 AT2G43795 AT3G59800 AT3G59800
fragaria_vesca	FvH4_1g00470
malus_domestica	MD02G1003900.v1.1 MD15G1147200.v1.1
prunus_persica	Prupe.7G267400_v2.0.a1 Prupe.7G267400_v2.0.a1
pyrus_communis	pycom02g00240 pycom15g13210
rosa_chinensis	RchiOBHm_Chr2g0084981
rosa_laevigata	RLG00000015653
rosa_multiflora	Rmu_sc0001196.1_g000004 Rmu_sc0008647.1_g000019
rosa_roxburghii	Rroxscaffold_2G00155660
rosa_rugosa	Rorug01G0457400 Rorug01G0457500
rosa_samantha	Rh2AG005400 Rh2BG006400 Rh2CG006900 Rh2DG006800
rosa_wichuraiana	Rw2G000510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	57
AclWI	GGATC	2 cut(s)	42, 55
AfiI	CCNNNNNNNGG	1 cut(s)	70
AgsI	TTSAA	1 cut(s)	453
AjnI	CCWGG	2 cut(s)	38, 161
AleI	CACNNNNGTG	1 cut(s)	112
AluBI	AGCT	3 cut(s)	17, 54, 283
AluI	AGCT	3 cut(s)	17, 54, 283
AlwI	GGATC	2 cut(s)	42, 55
AoxI	GGCC	1 cut(s)	61
ApeKI	GCWGC	6 cut(s)	122, 360, 363, 366, 369, 372
AspS9I	GGNCC	1 cut(s)	62
AsuHPI	GGTGA	1 cut(s)	99
AsuNHI	GCTAGC	1 cut(s)	134
BamHI	GGATCC	1 cut(s)	47
BanII	GRGCYC	2 cut(s)	256, 277
BbsI	GAAGAC	1 cut(s)	84
BbvI	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
BccI	CCATC	1 cut(s)	86
BceAI	ACGGC	1 cut(s)	97
BcgI	CGANNNNNNTGC	2 cut(s)	107, 141
BciT130I	CCWGG	2 cut(s)	40, 163
BfaI	CTAG	2 cut(s)	135, 306
BglI	GCCNNNNNGGC	1 cut(s)	272
BisI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
BlsI	GCNGC	6 cut(s)	124, 362, 365, 368, 371, 374
Bme1390I	CCNGG	2 cut(s)	40, 163
BmgT120I	GGNCC	1 cut(s)	62
BmiI	GGNNCC	2 cut(s)	49, 64
BmrFI	CCNGG	2 cut(s)	40, 163
BmsI	GCATC	1 cut(s)	253
BmtI	GCTAGC	1 cut(s)	138
BpiI	GAAGAC	1 cut(s)	84
BsaJI	CCNNGG	1 cut(s)	162
Bsc4I	CCNNNNNNNGG	1 cut(s)	70
Bse1I	ACTGG	3 cut(s)	219, 264, 425
Bse3DI	GCAATG	1 cut(s)	460
BseBI	CCWGG	2 cut(s)	40, 163
BseDI	CCNNGG	1 cut(s)	162
BseGI	GGATG	2 cut(s)	97, 268
BseLI	CCNNNNNNNGG	1 cut(s)	70
BseMI	GCAATG	1 cut(s)	460
BseMII	CTCAG	1 cut(s)	191
BseNI	ACTGG	3 cut(s)	219, 264, 425
BseRI	GAGGAG	1 cut(s)	182
BseXI	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
BseYI	CCCAGC	1 cut(s)	43
BshFI	GGCC	1 cut(s)	63
BslI	CCNNNNNNNGG	1 cut(s)	70
BsnI	GGCC	1 cut(s)	63
Bsp1286I	GDGCHC	2 cut(s)	256, 277
Bsp143I	GATC	2 cut(s)	47, 319
BspACI	CCGC	1 cut(s)	57
BspANI	GGCC	1 cut(s)	63
BspCNI	CTCAG	1 cut(s)	192
BspLI	GGNNCC	2 cut(s)	49, 64
BspOI	GCTAGC	1 cut(s)	138
BspPI	GGATC	2 cut(s)	42, 55
BsrDI	GCAATG	1 cut(s)	460
BsrI	ACTGG	3 cut(s)	219, 264, 425
BssECI	CCNNGG	1 cut(s)	162
BssMI	GATC	2 cut(s)	47, 319
Bst2UI	CCWGG	2 cut(s)	40, 163
BstC8I	GCNNGC	6 cut(s)	61, 120, 136, 277, 281, 285
BstDEI	CTNAG	1 cut(s)	200
BstF5I	GGATG	2 cut(s)	97, 268
BstKTI	GATC	2 cut(s)	50, 322
BstMBI	GATC	2 cut(s)	47, 319
BstMWI	GCNNNNNNNGC	7 cut(s)	23, 60, 131, 272, 366, 369, 372
BstNI	CCWGG	2 cut(s)	40, 163
BstNSI	RCATGY	1 cut(s)	122
BstSCI	CCNGG	2 cut(s)	38, 161
BstV1I	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
BstV2I	GAAGAC	1 cut(s)	84
BstX2I	RGATCY	1 cut(s)	47
BstYI	RGATCY	1 cut(s)	47
BsuRI	GGCC	1 cut(s)	63
BtsCI	GGATG	2 cut(s)	97, 268
BtsIMutI	CAGTG	1 cut(s)	418
Cac8I	GCNNGC	6 cut(s)	61, 120, 136, 277, 281, 285
Cfr13I	GGNCC	1 cut(s)	62
CviAII	CATG	3 cut(s)	85, 119, 483
DdeI	CTNAG	1 cut(s)	200
DpnI	GATC	2 cut(s)	49, 321
DpnII	GATC	2 cut(s)	47, 319
DraI	TTTAAA	1 cut(s)	351
Eco24I	GRGCYC	2 cut(s)	256, 277
EcoRII	CCWGG	2 cut(s)	38, 161
EcoT38I	GRGCYC	2 cut(s)	256, 277
FaeI	CATG	3 cut(s)	88, 122, 486
FaiI	YATR	7 cut(s)	29, 86, 120, 153, 174, 470, 484
FatI	CATG	3 cut(s)	84, 118, 482
Fnu4HI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
FokI	GGATG	2 cut(s)	104, 275
FriOI	GRGCYC	2 cut(s)	256, 277
Fsp4HI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
FspBI	CTAG	2 cut(s)	135, 306
GluI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
GsaI	CCCAGC	1 cut(s)	47
HaeIII	GGCC	1 cut(s)	63
Hin1II	CATG	3 cut(s)	88, 122, 486
HindIII	AAGCTT	2 cut(s)	15, 281
HinfI	GANTC	2 cut(s)	10, 439
HphI	GGTGA	1 cut(s)	99
Hpy188I	TCNGA	1 cut(s)	319
HpyAV	CCTTC	1 cut(s)	331
HpyCH4V	TGCA	3 cut(s)	31, 460, 465
HpyF10VI	GCNNNNNNNGC	7 cut(s)	23, 60, 131, 272, 366, 369, 372
HpyF3I	CTNAG	1 cut(s)	200
Hsp92II	CATG	3 cut(s)	88, 122, 486
Kzo9I	GATC	2 cut(s)	47, 319
LmnI	GCTCC	1 cut(s)	59
Lsp1109I	GCAGC	6 cut(s)	109, 372, 375, 378, 381, 384
LweI	GCATC	1 cut(s)	253
MaeI	CTAG	2 cut(s)	135, 306
MaeIII	GTNAC	1 cut(s)	416
MalI	GATC	2 cut(s)	49, 321
MboI	GATC	2 cut(s)	47, 319
MboII	GAAGA	3 cut(s)	89, 203, 306
MflI	RGATCY	1 cut(s)	47
MhlI	GDGCHC	2 cut(s)	256, 277
MluCI	AATT	1 cut(s)	156
MnlI	CCTC	2 cut(s)	64, 160
MseI	TTAA	2 cut(s)	141, 350
MslI	CAYNNNNRTG	1 cut(s)	112
MspA1I	CMGCKG	1 cut(s)	59
MspR9I	CCNGG	2 cut(s)	40, 163
MvaI	CCWGG	2 cut(s)	40, 163
MwoI	GCNNNNNNNGC	7 cut(s)	23, 60, 131, 272, 366, 369, 372
NdeII	GATC	2 cut(s)	47, 319
NheI	GCTAGC	1 cut(s)	134
NlaIII	CATG	3 cut(s)	88, 122, 486
NlaIV	GGNNCC	2 cut(s)	49, 64
NmuCI	GTSAC	1 cut(s)	416
NspI	RCATGY	1 cut(s)	122
OliI	CACNNNNGTG	1 cut(s)	112
PaeI	GCATGC	1 cut(s)	122
PfeI	GAWTC	2 cut(s)	10, 439
PkrI	GCNGC	6 cut(s)	124, 362, 365, 368, 371, 374
Psp6I	CCWGG	2 cut(s)	38, 161
PspFI	CCCAGC	1 cut(s)	43
PspGI	CCWGG	2 cut(s)	38, 161
PspN4I	GGNNCC	2 cut(s)	49, 64
PspPI	GGNCC	1 cut(s)	62
PsuI	RGATCY	1 cut(s)	47
RseI	CAYNNNNRTG	1 cut(s)	112
SaqAI	TTAA	2 cut(s)	141, 350
SatI	GCNGC	6 cut(s)	123, 361, 364, 367, 370, 373
Sau3AI	GATC	2 cut(s)	47, 319
Sau96I	GGNCC	1 cut(s)	62
ScrFI	CCNGG	2 cut(s)	40, 163
SduI	GDGCHC	2 cut(s)	256, 277
SetI	ASST	6 cut(s)	19, 56, 75, 164, 285, 390
SfaNI	GCATC	1 cut(s)	253
SmiMI	CAYNNNNRTG	1 cut(s)	112
SphI	GCATGC	1 cut(s)	122
Sse9I	AATT	1 cut(s)	156
SsiI	CCGC	1 cut(s)	57
SspMI	CTAG	2 cut(s)	135, 306
StyD4I	CCNGG	2 cut(s)	38, 161
TaqI	TCGA	1 cut(s)	75
TasI	AATT	1 cut(s)	156
TfiI	GAWTC	2 cut(s)	10, 439
Tru1I	TTAA	2 cut(s)	141, 350
Tru9I	TTAA	2 cut(s)	141, 350
TscAI	CASTG	1 cut(s)	425
TseFI	GTSAC	1 cut(s)	416
TseI	GCWGC	6 cut(s)	122, 360, 363, 366, 369, 372
Tsp45I	GTSAC	1 cut(s)	416
TspDTI	ATGAA	3 cut(s)	87, 92, 210
TspRI	CASTG	1 cut(s)	425
XceI	RCATGY	1 cut(s)	122
XspI	CTAG	2 cut(s)	135, 306

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.