Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001351.1

Orthogroup ID

OG0010289

Physical Location & Seq

Genomic Coordinates Forward (+)

25538 .. 26604

Gene Structure 1067 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001351.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 861 bp

atgaagaaccaagtacttctcttgcatctttcactatcagtatttctcctaatagttcccattgtagctcaacaatttgcatgtgacaccaaagcttccacaactagccaatttcctttttgcaatacttctctgccttatgaggaccgggccaaggacttggtctcgcgcctcactcttcaagaaaaggtccaacaactagtggatgcctccacaggcatttctcggctaggcgtgcctaaatatgagtggtggtccgaggcactccatggtgtttcgaacgttggcccaggcactcgctttaatgccacggtgcctggtgccactagtttcccagcagtgattctatctgcagcgagttttaatgaatcactatggttgaggatggggcaagttgtgtcaaccgaggctcgagccatgtacaatttgggtctagctgggttgacattttggagtcctaatgtcaatgtggtccgtgacccgagatggggtcgaacgcaagagacaccgggggaggaccccttagtggtgtcaaattatgcagtgaactatgtcaaaggtctccaagacgttggtgagggcaatgccactggtgacaagctcaaggtctcaagctgctgcaagcattacactgcttatgatattgataattggaaaggtgttgatagatttcactttgatgctcaggtgacaaaacaggacatggaggatacattccagccgccattcaaaagttgtgtgcaggagggccatgttagcagtgtcatgtgttcatataatagggtgaatgggattcccacctgtgctgacccagacctgcttcaaggggtagtcagaggccaatggggtctagatgggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

Fn3-like Glyco_hydro_3 Glyco_hydro_3_C

Protein Analysis

286

Amino Acids

31.47

Weight (kDa)

5.74

Isoelectric Point (pI)

32.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010289)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G19620
fragaria_vesca	FvH4_2g04280
malus_domestica	MD05G1099400.v1.1
prunus_persica	Prupe.8G143900_v2.0.a1
pyrus_communis	pycom05g09830
rosa_chinensis	RchiOBHm_Chr6g0253671 RchiOBHm_Chr6g0253691
rosa_laevigata	RLG00000014993
rosa_multiflora	Rmu_sc0000331.1_g000019 Rmu_sc0001351.1_g000008 Rmu_sc0006378.1_g000004 Rmu_sc0017598.1_g000001
rosa_roxburghii	Rroxscaffold_7G00211710
rosa_rugosa	Rorug05G0545400 Rorug05G0545500 Rorug05G0545600 Rorug05G0545700
rosa_samantha	Rh6AG061200 Rh6CG054800 Rh6DG052300
rosa_wichuraiana	Rw6G005440

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	825
AccB1I	GGYRCC	2 cut(s)	313, 320
AccII	CGCG	1 cut(s)	169
AciI	CCGC	1 cut(s)	722
AclI	AACGTT	1 cut(s)	282
AfaI	GTAC	2 cut(s)	15, 422
AfiI	CCNNNNNNNGG	4 cut(s)	154, 487, 488, 526
AgsI	TTSAA	3 cut(s)	182, 730, 824
AhlI	ACTAGT	2 cut(s)	199, 326
AjnI	CCWGG	2 cut(s)	289, 316
AluBI	AGCT	5 cut(s)	68, 95, 437, 601, 615
AluI	AGCT	5 cut(s)	68, 95, 437, 601, 615
Alw26I	GTCTC	4 cut(s)	169, 497, 566, 613
Ama87I	CYCGRG	2 cut(s)	411, 481
AoxI	GGCC	4 cut(s)	150, 286, 748, 838
ApeKI	GCWGC	3 cut(s)	353, 615, 618
AspLEI	GCGC	1 cut(s)	171
AspS9I	GGNCC	8 cut(s)	145, 150, 190, 255, 287, 472, 517, 748
AsuC2I	CCSGG	2 cut(s)	149, 510
AsuHPI	GGTGA	4 cut(s)	587, 605, 700, 796
AsuII	TTCGAA	1 cut(s)	278
AvaI	CYCGRG	2 cut(s)	411, 481
AvaII	GGWCC	5 cut(s)	145, 190, 255, 472, 517
BanI	GGYRCC	2 cut(s)	313, 320
BbvI	GCAGC	3 cut(s)	365, 602, 605
BccI	CCATC	3 cut(s)	379, 480, 848
BciT130I	CCWGG	2 cut(s)	291, 318
BciVI	GTATCC	1 cut(s)	703
BcnI	CCSGG	2 cut(s)	149, 510
BcoDI	GTCTC	4 cut(s)	169, 497, 566, 613
BcuI	ACTAGT	2 cut(s)	199, 326
BfaI	CTAG	6 cut(s)	105, 200, 230, 327, 434, 851
BfmI	CTRYAG	1 cut(s)	351
BfuAI	ACCTGC	1 cut(s)	825
BfuI	GTATCC	1 cut(s)	703
BisI	GCNGC	4 cut(s)	354, 616, 619, 722
BlsI	GCNGC	4 cut(s)	355, 617, 620, 723
BmcAI	AGTACT	1 cut(s)	15
Bme1390I	CCNGG	4 cut(s)	149, 291, 318, 510
Bme18I	GGWCC	5 cut(s)	145, 190, 255, 472, 517
BmeT110I	CYCGRG	2 cut(s)	411, 481
BmgT120I	GGNCC	8 cut(s)	145, 150, 190, 255, 287, 472, 517, 748
BmiI	GGNNCC	3 cut(s)	315, 322, 519
BmrFI	CCNGG	4 cut(s)	149, 291, 318, 510
BmsI	GCATC	3 cut(s)	34, 196, 670
Bpu10I	CCTNAGC	1 cut(s)	684
Bpu14I	TTCGAA	1 cut(s)	278
BpuEI	CTTGAG	2 cut(s)	587, 595
BpuMI	CCSGG	2 cut(s)	149, 510
BsaI	GGTCTC	3 cut(s)	169, 566, 613
BsaJI	CCNNGG	7 cut(s)	153, 258, 268, 289, 309, 405, 509
Bsc4I	CCNNNNNNNGG	4 cut(s)	154, 487, 488, 526
Bse1I	ACTGG	1 cut(s)	595
Bse3DI	GCAATG	1 cut(s)	589
BseBI	CCWGG	2 cut(s)	291, 318
BseDI	CCNNGG	7 cut(s)	153, 258, 268, 289, 309, 405, 509
BseGI	GGATG	2 cut(s)	211, 390
BseLI	CCNNNNNNNGG	4 cut(s)	154, 487, 488, 526
BseMI	GCAATG	1 cut(s)	589
BseMII	CTCAG	1 cut(s)	698
BseNI	ACTGG	1 cut(s)	595
BseXI	GCAGC	3 cut(s)	365, 602, 605
BseYI	CCCAGC	2 cut(s)	334, 437
BsgI	GTGCAG	1 cut(s)	761
Bsh1236I	CGCG	1 cut(s)	169
BshFI	GGCC	4 cut(s)	152, 288, 750, 840
BshNI	GGYRCC	2 cut(s)	313, 320
BsiHKCI	CYCGRG	2 cut(s)	411, 481
BsiSI	CCGG	2 cut(s)	148, 509
BslI	CCNNNNNNNGG	4 cut(s)	154, 487, 488, 526
BsmAI	GTCTC	4 cut(s)	169, 497, 566, 613
BsnI	GGCC	4 cut(s)	152, 288, 750, 840
Bso31I	GGTCTC	3 cut(s)	169, 566, 613
BsoBI	CYCGRG	2 cut(s)	411, 481
Bsp119I	TTCGAA	1 cut(s)	278
Bsp1407I	TGTACA	1 cut(s)	420
Bsp19I	CCATGG	1 cut(s)	268
BspACI	CCGC	1 cut(s)	722
BspANI	GGCC	4 cut(s)	152, 288, 750, 840
BspCNI	CTCAG	1 cut(s)	697
BspFNI	CGCG	1 cut(s)	169
BspLI	GGNNCC	3 cut(s)	315, 322, 519
BspMAI	CTGCAG	1 cut(s)	355
BspMI	ACCTGC	1 cut(s)	825
BspT104I	TTCGAA	1 cut(s)	278
BspT107I	GGYRCC	2 cut(s)	313, 320
BspTNI	GGTCTC	3 cut(s)	169, 566, 613
BsrDI	GCAATG	1 cut(s)	589
BsrGI	TGTACA	1 cut(s)	420
BsrI	ACTGG	1 cut(s)	595
BssECI	CCNNGG	7 cut(s)	153, 258, 268, 289, 309, 405, 509
BssT1I	CCWWGG	2 cut(s)	153, 268
Bst2UI	CCWGG	2 cut(s)	291, 318
Bst4CI	ACNGT	1 cut(s)	313
Bst6I	CTCTTC	1 cut(s)	183
BstAUI	TGTACA	1 cut(s)	420
BstBI	TTCGAA	1 cut(s)	278
BstC8I	GCNNGC	2 cut(s)	236, 623
BstDEI	CTNAG	2 cut(s)	523, 684
BstDSI	CCRYGG	2 cut(s)	268, 309
BstF5I	GGATG	2 cut(s)	211, 390
BstFNI	CGCG	1 cut(s)	169
BstHHI	GCGC	1 cut(s)	171
BstMAI	GTCTC	4 cut(s)	169, 497, 566, 613
BstMWI	GCNNNNNNNGC	2 cut(s)	235, 756
BstNI	CCWGG	2 cut(s)	291, 318
BstNSI	RCATGY	1 cut(s)	84
BstSCI	CCNGG	4 cut(s)	147, 289, 316, 508
BstSFI	CTRYAG	1 cut(s)	351
BstUI	CGCG	1 cut(s)	169
BstV1I	GCAGC	3 cut(s)	365, 602, 605
BstXI	CCANNNNNNTGG	2 cut(s)	160, 572
BsuI	GTATCC	1 cut(s)	703
BsuRI	GGCC	4 cut(s)	152, 288, 750, 840
BtgI	CCRYGG	2 cut(s)	268, 309
BtsCI	GGATG	2 cut(s)	211, 390
BtsI	GCAGTG	4 cut(s)	345, 549, 630, 766
BtsIMutI	CAGTG	5 cut(s)	345, 549, 588, 630, 766
BveI	ACCTGC	1 cut(s)	825
Cac8I	GCNNGC	2 cut(s)	236, 623
CfoI	GCGC	1 cut(s)	171
Cfr13I	GGNCC	8 cut(s)	145, 150, 190, 255, 287, 472, 517, 748
Csp6I	GTAC	2 cut(s)	14, 421
CviAII	CATG	6 cut(s)	81, 269, 418, 703, 752, 766
CviQI	GTAC	2 cut(s)	14, 421
DdeI	CTNAG	2 cut(s)	523, 684
Eam1104I	CTCTTC	1 cut(s)	183
EarI	CTCTTC	1 cut(s)	183
Eco130I	CCWWGG	2 cut(s)	153, 268
Eco31I	GGTCTC	3 cut(s)	169, 566, 613
Eco47I	GGWCC	5 cut(s)	145, 190, 255, 472, 517
Eco88I	CYCGRG	2 cut(s)	411, 481
EcoO109I	RGGNCCY	1 cut(s)	517
EcoRII	CCWGG	2 cut(s)	289, 316
EcoT14I	CCWWGG	2 cut(s)	153, 268
ErhI	CCWWGG	2 cut(s)	153, 268
FaeI	CATG	6 cut(s)	84, 272, 421, 706, 755, 769
FatI	CATG	6 cut(s)	80, 268, 417, 702, 751, 765
Fnu4HI	GCNGC	4 cut(s)	354, 616, 619, 722
FokI	GGATG	2 cut(s)	218, 397
Fsp4HI	GCNGC	4 cut(s)	354, 616, 619, 722
FspBI	CTAG	6 cut(s)	105, 200, 230, 327, 434, 851
GlaI	GCGC	1 cut(s)	170
GluI	GCNGC	4 cut(s)	354, 616, 619, 722
GsaI	CCCAGC	2 cut(s)	338, 441
HaeIII	GGCC	4 cut(s)	152, 288, 750, 840
HapII	CCGG	2 cut(s)	148, 509
HhaI	GCGC	1 cut(s)	171
Hin1II	CATG	6 cut(s)	84, 272, 421, 706, 755, 769
Hin6I	GCGC	1 cut(s)	169
HinP1I	GCGC	1 cut(s)	169
HincII	GTYRAC	2 cut(s)	402, 444
HindII	GTYRAC	2 cut(s)	402, 444
HindIII	AAGCTT	1 cut(s)	93
HinfI	GANTC	4 cut(s)	343, 368, 454, 793
HpaII	CCGG	2 cut(s)	148, 509
HphI	GGTGA	4 cut(s)	587, 605, 700, 796
Hpy166II	GTNNAC	3 cut(s)	402, 444, 547
Hpy188I	TCNGA	2 cut(s)	259, 836
Hpy188III	TCNNGA	2 cut(s)	182, 851
Hpy8I	GTNNAC	3 cut(s)	402, 444, 547
HpyCH4III	ACNGT	1 cut(s)	313
HpyCH4IV	ACGT	2 cut(s)	282, 570
HpyCH4V	TGCA	7 cut(s)	25, 80, 123, 353, 542, 621, 742
HpyF10VI	GCNNNNNNNGC	2 cut(s)	235, 756
HpyF3I	CTNAG	2 cut(s)	523, 684
HpySE526I	ACGT	2 cut(s)	282, 570
Hsp92II	CATG	6 cut(s)	84, 272, 421, 706, 755, 769
HspAI	GCGC	1 cut(s)	169
Lsp1109I	GCAGC	3 cut(s)	365, 602, 605
LweI	GCATC	3 cut(s)	34, 196, 670
MaeI	CTAG	6 cut(s)	105, 200, 230, 327, 434, 851
MaeII	ACGT	2 cut(s)	282, 570
MaeIII	GTNAC	4 cut(s)	83, 476, 593, 688
MboII	GAAGA	2 cut(s)	16, 170
MluCI	AATT	5 cut(s)	74, 110, 424, 535, 649
MlyI	GAGTC	1 cut(s)	463
MmeI	TCCRAC	1 cut(s)	217
MseI	TTAA	2 cut(s)	303, 363
MslI	CAYNNNNRTG	1 cut(s)	678
MspI	CCGG	2 cut(s)	148, 509
MspR9I	CCNGG	4 cut(s)	149, 291, 318, 510
MvaI	CCWGG	2 cut(s)	291, 318
MvnI	CGCG	1 cut(s)	169
MwoI	GCNNNNNNNGC	2 cut(s)	235, 756
NciI	CCSGG	2 cut(s)	149, 510
NcoI	CCATGG	1 cut(s)	268
NlaIII	CATG	6 cut(s)	84, 272, 421, 706, 755, 769
NlaIV	GGNNCC	3 cut(s)	315, 322, 519
NmeAIII	GCCGAG	1 cut(s)	205
NmuCI	GTSAC	4 cut(s)	83, 476, 593, 688
NspI	RCATGY	1 cut(s)	84
NspV	TTCGAA	1 cut(s)	278
PaeR7I	CTCGAG	1 cut(s)	411
PfeI	GAWTC	3 cut(s)	343, 368, 793
PflFI	GACNNNGTC	1 cut(s)	161
PkrI	GCNGC	4 cut(s)	355, 617, 620, 723
PleI	GAGTC	1 cut(s)	462
PpsI	GAGTC	1 cut(s)	462
PpuMI	RGGWCCY	1 cut(s)	517
Psp1406I	AACGTT	1 cut(s)	282
Psp5II	RGGWCCY	1 cut(s)	517
Psp6I	CCWGG	2 cut(s)	289, 316
PspFI	CCCAGC	2 cut(s)	334, 437
PspGI	CCWGG	2 cut(s)	289, 316
PspN4I	GGNNCC	3 cut(s)	315, 322, 519
PspPI	GGNCC	8 cut(s)	145, 150, 190, 255, 287, 472, 517, 748
PspPPI	RGGWCCY	1 cut(s)	517
PspXI	VCTCGAGB	1 cut(s)	411
PstI	CTGCAG	1 cut(s)	355
PsyI	GACNNNGTC	1 cut(s)	161
RsaI	GTAC	2 cut(s)	15, 422
RsaNI	GTAC	2 cut(s)	14, 421
RseI	CAYNNNNRTG	1 cut(s)	678
SaqAI	TTAA	2 cut(s)	303, 363
SatI	GCNGC	4 cut(s)	354, 616, 619, 722
Sau96I	GGNCC	8 cut(s)	145, 150, 190, 255, 287, 472, 517, 748
ScaI	AGTACT	1 cut(s)	15
SchI	GAGTC	1 cut(s)	463
ScrFI	CCNGG	4 cut(s)	149, 291, 318, 510
SfaNI	GCATC	3 cut(s)	34, 196, 670
SfcI	CTRYAG	1 cut(s)	351
Sfr274I	CTCGAG	1 cut(s)	411
SfuI	TTCGAA	1 cut(s)	278
SinI	GGWCC	5 cut(s)	145, 190, 255, 472, 517
SlaI	CTCGAG	1 cut(s)	411
SmiMI	CAYNNNNRTG	1 cut(s)	678
SmlI	CTYRAG	3 cut(s)	411, 602, 610
SmoI	CTYRAG	3 cut(s)	411, 602, 610
SpeI	ACTAGT	2 cut(s)	199, 326
Sse9I	AATT	5 cut(s)	74, 110, 424, 535, 649
SsiI	CCGC	1 cut(s)	722
SspMI	CTAG	6 cut(s)	105, 200, 230, 327, 434, 851
StyD4I	CCNGG	4 cut(s)	147, 289, 316, 508
StyI	CCWWGG	2 cut(s)	153, 268
TaaI	ACNGT	1 cut(s)	313
TaiI	ACGT	2 cut(s)	285, 573
TaqI	TCGA	3 cut(s)	278, 412, 493
TasI	AATT	5 cut(s)	74, 110, 424, 535, 649
TatI	WGTACW	2 cut(s)	13, 420
TauI	GCSGC	1 cut(s)	724
TfiI	GAWTC	3 cut(s)	343, 368, 793
Tru1I	TTAA	2 cut(s)	303, 363
Tru9I	TTAA	2 cut(s)	303, 363
TscAI	CASTG	5 cut(s)	345, 549, 595, 637, 766
TseFI	GTSAC	4 cut(s)	83, 476, 593, 688
TseI	GCWGC	3 cut(s)	353, 615, 618
Tsp45I	GTSAC	4 cut(s)	83, 476, 593, 688
TspDTI	ATGAA	3 cut(s)	17, 381, 762
TspGWI	ACGGA	1 cut(s)	464
TspRI	CASTG	5 cut(s)	345, 549, 595, 637, 766
Tth111I	GACNNNGTC	1 cut(s)	161
VpaK11BI	GGWCC	5 cut(s)	145, 190, 255, 472, 517
XbaI	TCTAGA	1 cut(s)	850
XceI	RCATGY	1 cut(s)	84
XcmI	CCANNNNNNNNNTGG	1 cut(s)	424
XhoI	CTCGAG	1 cut(s)	411
XspI	CTAG	6 cut(s)	105, 200, 230, 327, 434, 851
ZrmI	AGTACT	1 cut(s)	15

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.