Rmu_sc0001351.1_g000008

hydrolase activity, hydrolyzing O-glycosyl compounds

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001351.1
OG0010289
Physical Location & Seq
Forward (+)
25538 .. 26604
1067 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 861 bp
atgaagaaccaagtacttctcttgcatctttcactatcagtatttctcctaatagttcccattgtagctcaacaatttgcatgtgacaccaaagcttccacaactagccaatttcctttttgcaatacttctctgccttatgaggaccgggccaaggacttggtctcgcgcctcactcttcaagaaaaggtccaacaactagtggatgcctccacaggcatttctcggctaggcgtgcctaaatatgagtggtggtccgaggcactccatggtgtttcgaacgttggcccaggcactcgctttaatgccacggtgcctggtgccactagtttcccagcagtgattctatctgcagcgagttttaatgaatcactatggttgaggatggggcaagttgtgtcaaccgaggctcgagccatgtacaatttgggtctagctgggttgacattttggagtcctaatgtcaatgtggtccgtgacccgagatggggtcgaacgcaagagacaccgggggaggaccccttagtggtgtcaaattatgcagtgaactatgtcaaaggtctccaagacgttggtgagggcaatgccactggtgacaagctcaaggtctcaagctgctgcaagcattacactgcttatgatattgataattggaaaggtgttgatagatttcactttgatgctcaggtgacaaaacaggacatggaggatacattccagccgccattcaaaagttgtgtgcaggagggccatgttagcagtgtcatgtgttcatataatagggtgaatgggattcccacctgtgctgacccagacctgcttcaaggggtagtcagaggccaatggggtctagatgggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00520 ko01100 map00520 map01100
Pfam Domains
Protein Families
Fn3-like Glyco_hydro_3 Glyco_hydro_3_C

Protein Analysis

286

Amino Acids

31.47

Weight (kDa)

5.74

Isoelectric Point (pI)

32.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_3 PF00933 107 - 286 7.2e-26 Glycosyl hydrolase family 3 N terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 825
AccB1I GGYRCC 2 cut(s) 313, 320
AccII CGCG 1 cut(s) 169
AciI CCGC 1 cut(s) 722
AclI AACGTT 1 cut(s) 282
AfaI GTAC 2 cut(s) 15, 422
AfiI CCNNNNNNNGG 4 cut(s) 154, 487, 488, 526
AgsI TTSAA 3 cut(s) 182, 730, 824
AhlI ACTAGT 2 cut(s) 199, 326
AjnI CCWGG 2 cut(s) 289, 316
AluBI AGCT 5 cut(s) 68, 95, 437, 601, 615
AluI AGCT 5 cut(s) 68, 95, 437, 601, 615
Alw26I GTCTC 4 cut(s) 169, 497, 566, 613
Ama87I CYCGRG 2 cut(s) 411, 481
AoxI GGCC 4 cut(s) 150, 286, 748, 838
ApeKI GCWGC 3 cut(s) 353, 615, 618
AspLEI GCGC 1 cut(s) 171
AspS9I GGNCC 8 cut(s) 145, 150, 190, 255, 287, 472, 517, 748
AsuC2I CCSGG 2 cut(s) 149, 510
AsuHPI GGTGA 4 cut(s) 587, 605, 700, 796
AsuII TTCGAA 1 cut(s) 278
AvaI CYCGRG 2 cut(s) 411, 481
AvaII GGWCC 5 cut(s) 145, 190, 255, 472, 517
BanI GGYRCC 2 cut(s) 313, 320
BbvI GCAGC 3 cut(s) 365, 602, 605
BccI CCATC 3 cut(s) 379, 480, 848
BciT130I CCWGG 2 cut(s) 291, 318
BciVI GTATCC 1 cut(s) 703
BcnI CCSGG 2 cut(s) 149, 510
BcoDI GTCTC 4 cut(s) 169, 497, 566, 613
BcuI ACTAGT 2 cut(s) 199, 326
BfaI CTAG 6 cut(s) 105, 200, 230, 327, 434, 851
BfmI CTRYAG 1 cut(s) 351
BfuAI ACCTGC 1 cut(s) 825
BfuI GTATCC 1 cut(s) 703
BisI GCNGC 4 cut(s) 354, 616, 619, 722
BlsI GCNGC 4 cut(s) 355, 617, 620, 723
BmcAI AGTACT 1 cut(s) 15
Bme1390I CCNGG 4 cut(s) 149, 291, 318, 510
Bme18I GGWCC 5 cut(s) 145, 190, 255, 472, 517
BmeT110I CYCGRG 2 cut(s) 411, 481
BmgT120I GGNCC 8 cut(s) 145, 150, 190, 255, 287, 472, 517, 748
BmiI GGNNCC 3 cut(s) 315, 322, 519
BmrFI CCNGG 4 cut(s) 149, 291, 318, 510
BmsI GCATC 3 cut(s) 34, 196, 670
Bpu10I CCTNAGC 1 cut(s) 684
Bpu14I TTCGAA 1 cut(s) 278
BpuEI CTTGAG 2 cut(s) 587, 595
BpuMI CCSGG 2 cut(s) 149, 510
BsaI GGTCTC 3 cut(s) 169, 566, 613
BsaJI CCNNGG 7 cut(s) 153, 258, 268, 289, 309, 405, 509
Bsc4I CCNNNNNNNGG 4 cut(s) 154, 487, 488, 526
Bse1I ACTGG 1 cut(s) 595
Bse3DI GCAATG 1 cut(s) 589
BseBI CCWGG 2 cut(s) 291, 318
BseDI CCNNGG 7 cut(s) 153, 258, 268, 289, 309, 405, 509
BseGI GGATG 2 cut(s) 211, 390
BseLI CCNNNNNNNGG 4 cut(s) 154, 487, 488, 526
BseMI GCAATG 1 cut(s) 589
BseMII CTCAG 1 cut(s) 698
BseNI ACTGG 1 cut(s) 595
BseXI GCAGC 3 cut(s) 365, 602, 605
BseYI CCCAGC 2 cut(s) 334, 437
BsgI GTGCAG 1 cut(s) 761
Bsh1236I CGCG 1 cut(s) 169
BshFI GGCC 4 cut(s) 152, 288, 750, 840
BshNI GGYRCC 2 cut(s) 313, 320
BsiHKCI CYCGRG 2 cut(s) 411, 481
BsiSI CCGG 2 cut(s) 148, 509
BslI CCNNNNNNNGG 4 cut(s) 154, 487, 488, 526
BsmAI GTCTC 4 cut(s) 169, 497, 566, 613
BsnI GGCC 4 cut(s) 152, 288, 750, 840
Bso31I GGTCTC 3 cut(s) 169, 566, 613
BsoBI CYCGRG 2 cut(s) 411, 481
Bsp119I TTCGAA 1 cut(s) 278
Bsp1407I TGTACA 1 cut(s) 420
Bsp19I CCATGG 1 cut(s) 268
BspACI CCGC 1 cut(s) 722
BspANI GGCC 4 cut(s) 152, 288, 750, 840
BspCNI CTCAG 1 cut(s) 697
BspFNI CGCG 1 cut(s) 169
BspLI GGNNCC 3 cut(s) 315, 322, 519
BspMAI CTGCAG 1 cut(s) 355
BspMI ACCTGC 1 cut(s) 825
BspT104I TTCGAA 1 cut(s) 278
BspT107I GGYRCC 2 cut(s) 313, 320
BspTNI GGTCTC 3 cut(s) 169, 566, 613
BsrDI GCAATG 1 cut(s) 589
BsrGI TGTACA 1 cut(s) 420
BsrI ACTGG 1 cut(s) 595
BssECI CCNNGG 7 cut(s) 153, 258, 268, 289, 309, 405, 509
BssT1I CCWWGG 2 cut(s) 153, 268
Bst2UI CCWGG 2 cut(s) 291, 318
Bst4CI ACNGT 1 cut(s) 313
Bst6I CTCTTC 1 cut(s) 183
BstAUI TGTACA 1 cut(s) 420
BstBI TTCGAA 1 cut(s) 278
BstC8I GCNNGC 2 cut(s) 236, 623
BstDEI CTNAG 2 cut(s) 523, 684
BstDSI CCRYGG 2 cut(s) 268, 309
BstF5I GGATG 2 cut(s) 211, 390
BstFNI CGCG 1 cut(s) 169
BstHHI GCGC 1 cut(s) 171
BstMAI GTCTC 4 cut(s) 169, 497, 566, 613
BstMWI GCNNNNNNNGC 2 cut(s) 235, 756
BstNI CCWGG 2 cut(s) 291, 318
BstNSI RCATGY 1 cut(s) 84
BstSCI CCNGG 4 cut(s) 147, 289, 316, 508
BstSFI CTRYAG 1 cut(s) 351
BstUI CGCG 1 cut(s) 169
BstV1I GCAGC 3 cut(s) 365, 602, 605
BstXI CCANNNNNNTGG 2 cut(s) 160, 572
BsuI GTATCC 1 cut(s) 703
BsuRI GGCC 4 cut(s) 152, 288, 750, 840
BtgI CCRYGG 2 cut(s) 268, 309
BtsCI GGATG 2 cut(s) 211, 390
BtsI GCAGTG 4 cut(s) 345, 549, 630, 766
BtsIMutI CAGTG 5 cut(s) 345, 549, 588, 630, 766
BveI ACCTGC 1 cut(s) 825
Cac8I GCNNGC 2 cut(s) 236, 623
CfoI GCGC 1 cut(s) 171
Cfr13I GGNCC 8 cut(s) 145, 150, 190, 255, 287, 472, 517, 748
Csp6I GTAC 2 cut(s) 14, 421
CviAII CATG 6 cut(s) 81, 269, 418, 703, 752, 766
CviQI GTAC 2 cut(s) 14, 421
DdeI CTNAG 2 cut(s) 523, 684
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco130I CCWWGG 2 cut(s) 153, 268
Eco31I GGTCTC 3 cut(s) 169, 566, 613
Eco47I GGWCC 5 cut(s) 145, 190, 255, 472, 517
Eco88I CYCGRG 2 cut(s) 411, 481
EcoO109I RGGNCCY 1 cut(s) 517
EcoRII CCWGG 2 cut(s) 289, 316
EcoT14I CCWWGG 2 cut(s) 153, 268
ErhI CCWWGG 2 cut(s) 153, 268
FaeI CATG 6 cut(s) 84, 272, 421, 706, 755, 769
FatI CATG 6 cut(s) 80, 268, 417, 702, 751, 765
Fnu4HI GCNGC 4 cut(s) 354, 616, 619, 722
FokI GGATG 2 cut(s) 218, 397
Fsp4HI GCNGC 4 cut(s) 354, 616, 619, 722
FspBI CTAG 6 cut(s) 105, 200, 230, 327, 434, 851
GlaI GCGC 1 cut(s) 170
GluI GCNGC 4 cut(s) 354, 616, 619, 722
GsaI CCCAGC 2 cut(s) 338, 441
HaeIII GGCC 4 cut(s) 152, 288, 750, 840
HapII CCGG 2 cut(s) 148, 509
HhaI GCGC 1 cut(s) 171
Hin1II CATG 6 cut(s) 84, 272, 421, 706, 755, 769
Hin6I GCGC 1 cut(s) 169
HinP1I GCGC 1 cut(s) 169
HincII GTYRAC 2 cut(s) 402, 444
HindII GTYRAC 2 cut(s) 402, 444
HindIII AAGCTT 1 cut(s) 93
HinfI GANTC 4 cut(s) 343, 368, 454, 793
HpaII CCGG 2 cut(s) 148, 509
HphI GGTGA 4 cut(s) 587, 605, 700, 796
Hpy166II GTNNAC 3 cut(s) 402, 444, 547
Hpy188I TCNGA 2 cut(s) 259, 836
Hpy188III TCNNGA 2 cut(s) 182, 851
Hpy8I GTNNAC 3 cut(s) 402, 444, 547
HpyCH4III ACNGT 1 cut(s) 313
HpyCH4IV ACGT 2 cut(s) 282, 570
HpyCH4V TGCA 7 cut(s) 25, 80, 123, 353, 542, 621, 742
HpyF10VI GCNNNNNNNGC 2 cut(s) 235, 756
HpyF3I CTNAG 2 cut(s) 523, 684
HpySE526I ACGT 2 cut(s) 282, 570
Hsp92II CATG 6 cut(s) 84, 272, 421, 706, 755, 769
HspAI GCGC 1 cut(s) 169
Lsp1109I GCAGC 3 cut(s) 365, 602, 605
LweI GCATC 3 cut(s) 34, 196, 670
MaeI CTAG 6 cut(s) 105, 200, 230, 327, 434, 851
MaeII ACGT 2 cut(s) 282, 570
MaeIII GTNAC 4 cut(s) 83, 476, 593, 688
MboII GAAGA 2 cut(s) 16, 170
MluCI AATT 5 cut(s) 74, 110, 424, 535, 649
MlyI GAGTC 1 cut(s) 463
MmeI TCCRAC 1 cut(s) 217
MseI TTAA 2 cut(s) 303, 363
MslI CAYNNNNRTG 1 cut(s) 678
MspI CCGG 2 cut(s) 148, 509
MspR9I CCNGG 4 cut(s) 149, 291, 318, 510
MvaI CCWGG 2 cut(s) 291, 318
MvnI CGCG 1 cut(s) 169
MwoI GCNNNNNNNGC 2 cut(s) 235, 756
NciI CCSGG 2 cut(s) 149, 510
NcoI CCATGG 1 cut(s) 268
NlaIII CATG 6 cut(s) 84, 272, 421, 706, 755, 769
NlaIV GGNNCC 3 cut(s) 315, 322, 519
NmeAIII GCCGAG 1 cut(s) 205
NmuCI GTSAC 4 cut(s) 83, 476, 593, 688
NspI RCATGY 1 cut(s) 84
NspV TTCGAA 1 cut(s) 278
PaeR7I CTCGAG 1 cut(s) 411
PfeI GAWTC 3 cut(s) 343, 368, 793
PflFI GACNNNGTC 1 cut(s) 161
PkrI GCNGC 4 cut(s) 355, 617, 620, 723
PleI GAGTC 1 cut(s) 462
PpsI GAGTC 1 cut(s) 462
PpuMI RGGWCCY 1 cut(s) 517
Psp1406I AACGTT 1 cut(s) 282
Psp5II RGGWCCY 1 cut(s) 517
Psp6I CCWGG 2 cut(s) 289, 316
PspFI CCCAGC 2 cut(s) 334, 437
PspGI CCWGG 2 cut(s) 289, 316
PspN4I GGNNCC 3 cut(s) 315, 322, 519
PspPI GGNCC 8 cut(s) 145, 150, 190, 255, 287, 472, 517, 748
PspPPI RGGWCCY 1 cut(s) 517
PspXI VCTCGAGB 1 cut(s) 411
PstI CTGCAG 1 cut(s) 355
PsyI GACNNNGTC 1 cut(s) 161
RsaI GTAC 2 cut(s) 15, 422
RsaNI GTAC 2 cut(s) 14, 421
RseI CAYNNNNRTG 1 cut(s) 678
SaqAI TTAA 2 cut(s) 303, 363
SatI GCNGC 4 cut(s) 354, 616, 619, 722
Sau96I GGNCC 8 cut(s) 145, 150, 190, 255, 287, 472, 517, 748
ScaI AGTACT 1 cut(s) 15
SchI GAGTC 1 cut(s) 463
ScrFI CCNGG 4 cut(s) 149, 291, 318, 510
SfaNI GCATC 3 cut(s) 34, 196, 670
SfcI CTRYAG 1 cut(s) 351
Sfr274I CTCGAG 1 cut(s) 411
SfuI TTCGAA 1 cut(s) 278
SinI GGWCC 5 cut(s) 145, 190, 255, 472, 517
SlaI CTCGAG 1 cut(s) 411
SmiMI CAYNNNNRTG 1 cut(s) 678
SmlI CTYRAG 3 cut(s) 411, 602, 610
SmoI CTYRAG 3 cut(s) 411, 602, 610
SpeI ACTAGT 2 cut(s) 199, 326
Sse9I AATT 5 cut(s) 74, 110, 424, 535, 649
SsiI CCGC 1 cut(s) 722
SspMI CTAG 6 cut(s) 105, 200, 230, 327, 434, 851
StyD4I CCNGG 4 cut(s) 147, 289, 316, 508
StyI CCWWGG 2 cut(s) 153, 268
TaaI ACNGT 1 cut(s) 313
TaiI ACGT 2 cut(s) 285, 573
TaqI TCGA 3 cut(s) 278, 412, 493
TasI AATT 5 cut(s) 74, 110, 424, 535, 649
TatI WGTACW 2 cut(s) 13, 420
TauI GCSGC 1 cut(s) 724
TfiI GAWTC 3 cut(s) 343, 368, 793
Tru1I TTAA 2 cut(s) 303, 363
Tru9I TTAA 2 cut(s) 303, 363
TscAI CASTG 5 cut(s) 345, 549, 595, 637, 766
TseFI GTSAC 4 cut(s) 83, 476, 593, 688
TseI GCWGC 3 cut(s) 353, 615, 618
Tsp45I GTSAC 4 cut(s) 83, 476, 593, 688
TspDTI ATGAA 3 cut(s) 17, 381, 762
TspGWI ACGGA 1 cut(s) 464
TspRI CASTG 5 cut(s) 345, 549, 595, 637, 766
Tth111I GACNNNGTC 1 cut(s) 161
VpaK11BI GGWCC 5 cut(s) 145, 190, 255, 472, 517
XbaI TCTAGA 1 cut(s) 850
XceI RCATGY 1 cut(s) 84
XcmI CCANNNNNNNNNTGG 1 cut(s) 424
XhoI CTCGAG 1 cut(s) 411
XspI CTAG 6 cut(s) 105, 200, 230, 327, 434, 851
ZrmI AGTACT 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.