Rmu_sc0001484.1_g000009

Belongs to the glycosyl hydrolase 43 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001484.1
Physical Location & Seq
Forward (+)
45828 .. 49064
3237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001484.1_g000009.1.cds

Sequence Viewer

Length: 1410 bp
atgaggatgaggaacaaatacaggaaaccaaccactttccgttgccatgcagggagcagatgttcaatatctgctgtggtgtggagcttagtaggatgtctacttatgtttcatctctactccctggttcaccggaaggatgggatgggcagagaaattcaatttggagcaagtcaccacccacagttacgtgaactagaaaaggttgaagaggaaagtatccacattcctccaccaagaaagcgatccccacgtgctgcaaaaagaaaacctaagcgacccaccacaataatcgatgaatttcttgatgagaattctcaaattcggcatgtattctttcctgatcagaaacttgctgtagatccgatgaaggatgcggggaatgatagctattactattaccctggaaggatttggttggatactgaaggaaatcctattcaagcccatggaggtggtattctatatgatgaaaaatcaggaacatactattggtatggggagtataaagatgggcctacataccatgctcacaaaaaaggagcagcccgggttgacatcttaggagtcggttgttattcttccaaggacttatggaaatggaacaatgaaggtattgtactagcagcagaaaaaacaaacgaaacacatgatctccacgagttgaatgttcttgagaggccaaaagtgatttacaatcacaagacagcgaagtatgtaatgtggatgcatattgatgatgtcaactacaccaaagcttctgttggcattgccgtcagtgattacccaactggtccttttgattatctctatagcaaacggccccatggatttgaaagtagggacatgacaatcttcaaagatgatgacggtattgcatatctaatatactcctctgaggacaatagtgaacttcacattggacctctaactgaagattatcttgatgtgaccaacatcatgagaagaattcttgtgggacagcatcgagaagccccagctctgttcaagcatgagggaacttattacatgatcacttcaggctgcacaggatgggcaccaaatgaagcactggcacatgcagcagagtcaatcatggggccatgggagactatgggaaacccctgcataggagggaacaaaatggctcgactaacaacattttttgcgcagagcacatttgtgatatctttaccaggatttcctggttcatttattttcatggcagacagatggaaccccgcagacttgagagactcaagatatgtatggttgcccttgatagtaggggggccagttgatcggccccttgattacaattttgggttccccttgtggtcaagagtgtccatatattggcataggaagtggaaacttcctcaggggtggagtgggtggaaaaaaatatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

469

Amino Acids

53.96

Weight (kDa)

8.49

Isoelectric Point (pI)

44.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 1170
AccB1I GGYRCC 1 cut(s) 1057
AccB7I CCANNNNNTGG 1 cut(s) 1356
AccI GTMKAC 1 cut(s) 100
AciI CCGC 2 cut(s) 377, 1242
AclWI GGATC 2 cut(s) 240, 356
AcsI RAATTY 5 cut(s) 156, 299, 313, 321, 969
AcuI CTGAAG 3 cut(s) 447, 954, 1023
AcvI CACGTG 1 cut(s) 254
AfaI GTAC 1 cut(s) 621
AfiI CCNNNNNNNGG 2 cut(s) 1130, 1356
AgsI TTSAA 8 cut(s) 66, 161, 209, 443, 667, 836, 859, 1009
AjnI CCWGG 4 cut(s) 123, 403, 1195, 1204
AjuI GAANNNNNNNTTGG 6 cut(s) 147, 179, 475, 507, 903, 935
AleI CACNNNNGTG 1 cut(s) 1181
AloI GAACNNNNNNTCC 2 cut(s) 46, 78
AluBI AGCT 4 cut(s) 87, 390, 758, 1001
AluI AGCT 4 cut(s) 87, 390, 758, 1001
Alw21I GWGCWC 1 cut(s) 1178
Alw26I GTCTC 2 cut(s) 1103, 1248
AlwI GGATC 2 cut(s) 240, 356
Ama87I CYCGRG 1 cut(s) 549
AoxI GGCC 6 cut(s) 515, 680, 821, 1100, 1292, 1304
ApeKI GCWGC 5 cut(s) 257, 545, 626, 1044, 1082
ApoI RAATTY 5 cut(s) 156, 299, 313, 321, 969
AspLEI GCGC 1 cut(s) 1171
AspS9I GGNCC 7 cut(s) 515, 794, 822, 923, 1100, 1292, 1305
AsuC2I CCSGG 2 cut(s) 550, 551
AsuHPI GGTGA 2 cut(s) 122, 167
AvaI CYCGRG 1 cut(s) 549
AvaII GGWCC 2 cut(s) 794, 923
AxyI CCTNAGG 1 cut(s) 1380
BaeGI GKGCMC 1 cut(s) 1060
BanI GGYRCC 1 cut(s) 1057
BarI GAAGNNNNNNTAC 2 cut(s) 603, 635
BauI CACGAG 1 cut(s) 659
BbrPI CACGTG 1 cut(s) 254
Bbv12I GWGCWC 1 cut(s) 1178
BbvI GCAGC 5 cut(s) 244, 557, 638, 1031, 1094
BccI CCATC 5 cut(s) 134, 139, 506, 1047, 1227
BceAI ACGGC 2 cut(s) 758, 836
BciT130I CCWGG 4 cut(s) 125, 405, 1197, 1206
BciVI GTATCC 2 cut(s) 230, 415
BclI TGATCA 2 cut(s) 343, 1032
BcnI CCSGG 2 cut(s) 550, 551
BcoDI GTCTC 2 cut(s) 1103, 1248
BfaI CTAG 2 cut(s) 197, 623
BfmI CTRYAG 2 cut(s) 357, 811
BfuI GTATCC 2 cut(s) 230, 415
BisI GCNGC 5 cut(s) 258, 546, 627, 1045, 1083
BlsI GCNGC 5 cut(s) 259, 547, 628, 1046, 1084
Bme1390I CCNGG 6 cut(s) 125, 405, 550, 551, 1197, 1206
Bme18I GGWCC 2 cut(s) 794, 923
BmeT110I CYCGRG 1 cut(s) 549
BmgT120I GGNCC 7 cut(s) 515, 794, 822, 923, 1100, 1292, 1305
BmiI GGNNCC 7 cut(s) 824, 1059, 1101, 1238, 1293, 1307, 1328
BmrFI CCNGG 6 cut(s) 125, 405, 550, 551, 1197, 1206
BmsI GCATC 3 cut(s) 364, 717, 994
Bpu10I CCTNAGC 1 cut(s) 273
BpuEI CTTGAG 3 cut(s) 695, 1243, 1270
BpuMI CCSGG 2 cut(s) 550, 551
Bsa29I ATCGAT 1 cut(s) 294
BsaAI YACGTR 2 cut(s) 191, 254
BsaJI CCNNGG 7 cut(s) 123, 403, 448, 549, 585, 826, 1103
BsaWI WCCGGW 1 cut(s) 132
BsaXI ACNNNNNCTCC 4 cut(s) 46, 76, 639, 669
Bsc4I CCNNNNNNNGG 2 cut(s) 1130, 1356
Bse1I ACTGG 3 cut(s) 796, 1077, 1295
Bse21I CCTNAGG 1 cut(s) 1380
Bse3DI GCAATG 1 cut(s) 768
BseBI CCWGG 4 cut(s) 125, 405, 1197, 1206
BseCI ATCGAT 1 cut(s) 294
BseDI CCNNGG 7 cut(s) 123, 403, 448, 549, 585, 826, 1103
BseGI GGATG 7 cut(s) 12, 101, 145, 150, 379, 732, 1058
BseLI CCNNNNNNNGG 2 cut(s) 1130, 1356
BseMI GCAATG 1 cut(s) 768
BseMII CTCAG 2 cut(s) 888, 1394
BseNI ACTGG 3 cut(s) 796, 1077, 1295
BseRI GAGGAG 1 cut(s) 883
BseSI GKGCMC 1 cut(s) 1060
BseXI GCAGC 5 cut(s) 244, 557, 638, 1031, 1094
BseYI CCCAGC 1 cut(s) 997
BsgI GTGCAG 1 cut(s) 1030
BshFI GGCC 6 cut(s) 517, 682, 823, 1102, 1294, 1306
BshNI GGYRCC 1 cut(s) 1057
BshVI ATCGAT 1 cut(s) 294
BsiHKAI GWGCWC 1 cut(s) 1178
BsiHKCI CYCGRG 1 cut(s) 549
BsiSI CCGG 2 cut(s) 133, 550
BslFI GGGAC 2 cut(s) 857, 993
BslI CCNNNNNNNGG 2 cut(s) 1130, 1356
BsmAI GTCTC 2 cut(s) 1103, 1248
BsmFI GGGAC 2 cut(s) 857, 993
BsnI GGCC 6 cut(s) 517, 682, 823, 1102, 1294, 1306
BsoBI CYCGRG 1 cut(s) 549
Bsp1286I GDGCHC 2 cut(s) 1060, 1178
Bsp143I GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
Bsp19I CCATGG 3 cut(s) 448, 826, 1103
BspACI CCGC 2 cut(s) 377, 1242
BspANI GGCC 6 cut(s) 517, 682, 823, 1102, 1294, 1306
BspCNI CTCAG 2 cut(s) 889, 1393
BspDI ATCGAT 1 cut(s) 294
BspHI TCATGA 1 cut(s) 960
BspLI GGNNCC 7 cut(s) 824, 1059, 1101, 1238, 1293, 1307, 1328
BspPI GGATC 2 cut(s) 240, 356
BspT107I GGYRCC 1 cut(s) 1057
BsrDI GCAATG 1 cut(s) 768
BsrI ACTGG 3 cut(s) 796, 1077, 1295
BssECI CCNNGG 7 cut(s) 123, 403, 448, 549, 585, 826, 1103
BssMI GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
BssSI CACGAG 1 cut(s) 659
BssT1I CCWWGG 4 cut(s) 448, 585, 826, 1103
Bst2BI CACGAG 1 cut(s) 659
Bst2UI CCWGG 4 cut(s) 125, 405, 1197, 1206
Bst4CI ACNGT 2 cut(s) 186, 872
Bst6I CTCTTC 1 cut(s) 204
BstBAI YACGTR 2 cut(s) 191, 254
BstDEI CTNAG 5 cut(s) 88, 273, 562, 897, 1380
BstDSI CCRYGG 3 cut(s) 448, 826, 1103
BstF5I GGATG 7 cut(s) 12, 101, 145, 150, 379, 732, 1058
BstHHI GCGC 1 cut(s) 1171
BstKTI GATC 6 cut(s) 248, 346, 364, 655, 1035, 1303
BstMAI GTCTC 2 cut(s) 1103, 1248
BstMBI GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
BstMWI GCNNNNNNNGC 1 cut(s) 1082
BstNI CCWGG 4 cut(s) 125, 405, 1197, 1206
BstNSI RCATGY 2 cut(s) 332, 1082
BstSCI CCNGG 6 cut(s) 123, 403, 548, 549, 1195, 1204
BstSFI CTRYAG 2 cut(s) 357, 811
BstSLI GKGCMC 1 cut(s) 1060
BstV1I GCAGC 5 cut(s) 244, 557, 638, 1031, 1094
BstX2I RGATCY 1 cut(s) 361
BstXI CCANNNNNNTGG 1 cut(s) 455
BstYI RGATCY 1 cut(s) 361
Bsu15I ATCGAT 1 cut(s) 294
Bsu36I CCTNAGG 1 cut(s) 1380
BsuI GTATCC 2 cut(s) 230, 415
BsuRI GGCC 6 cut(s) 517, 682, 823, 1102, 1294, 1306
BsuTUI ATCGAT 1 cut(s) 294
BtgI CCRYGG 3 cut(s) 448, 826, 1103
BtsCI GGATG 7 cut(s) 12, 101, 145, 150, 379, 732, 1058
BtsIMutI CAGTG 2 cut(s) 784, 1070
CciI TCATGA 1 cut(s) 960
CfoI GCGC 1 cut(s) 1171
Cfr13I GGNCC 7 cut(s) 515, 794, 822, 923, 1100, 1292, 1305
Cfr9I CCCGGG 1 cut(s) 549
ClaI ATCGAT 1 cut(s) 294
Csp6I GTAC 1 cut(s) 620
CviQI GTAC 1 cut(s) 620
DdeI CTNAG 5 cut(s) 88, 273, 562, 897, 1380
DpnI GATC 6 cut(s) 247, 345, 363, 654, 1034, 1302
DpnII GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
Eam1104I CTCTTC 1 cut(s) 204
EarI CTCTTC 1 cut(s) 204
Eco130I CCWWGG 4 cut(s) 448, 585, 826, 1103
Eco32I GATATC 1 cut(s) 1188
Eco47I GGWCC 2 cut(s) 794, 923
Eco57I CTGAAG 3 cut(s) 447, 954, 1023
Eco72I CACGTG 1 cut(s) 254
Eco81I CCTNAGG 1 cut(s) 1380
Eco88I CYCGRG 1 cut(s) 549
EcoRI GAATTC 2 cut(s) 313, 969
EcoRII CCWGG 4 cut(s) 123, 403, 1195, 1204
EcoRV GATATC 1 cut(s) 1188
EcoT14I CCWWGG 4 cut(s) 448, 585, 826, 1103
EcoT22I ATGCAT 1 cut(s) 732
ErhI CCWWGG 4 cut(s) 448, 585, 826, 1103
FalI AAGNNNNNCTT 2 cut(s) 927, 959
FaqI GGGAC 2 cut(s) 857, 993
FauI CCCGC 2 cut(s) 370, 1249
FbaI TGATCA 2 cut(s) 343, 1032
FblI GTMKAC 1 cut(s) 100
Fnu4HI GCNGC 5 cut(s) 258, 546, 627, 1045, 1083
FokI GGATG 7 cut(s) 19, 108, 152, 157, 386, 739, 1065
Fsp4HI GCNGC 5 cut(s) 258, 546, 627, 1045, 1083
FspBI CTAG 2 cut(s) 197, 623
FspI TGCGCA 1 cut(s) 1170
GlaI GCGC 1 cut(s) 1170
GluI GCNGC 5 cut(s) 258, 546, 627, 1045, 1083
GsaI CCCAGC 1 cut(s) 1001
HaeIII GGCC 6 cut(s) 517, 682, 823, 1102, 1294, 1306
HapII CCGG 2 cut(s) 133, 550
HhaI GCGC 1 cut(s) 1171
Hin6I GCGC 1 cut(s) 1169
HinP1I GCGC 1 cut(s) 1169
HincII GTYRAC 2 cut(s) 556, 745
HindII GTYRAC 2 cut(s) 556, 745
HindIII AAGCTT 1 cut(s) 756
HinfI GANTC 3 cut(s) 567, 1088, 1256
HpaII CCGG 2 cut(s) 133, 550
HphI GGTGA 2 cut(s) 122, 167
Hpy166II GTNNAC 6 cut(s) 101, 130, 194, 556, 745, 911
Hpy188I TCNGA 3 cut(s) 348, 366, 898
Hpy188III TCNNGA 9 cut(s) 305, 341, 480, 674, 944, 961, 989, 1260, 1341
Hpy8I GTNNAC 6 cut(s) 101, 130, 194, 556, 745, 911
HpyAV CCTTC 5 cut(s) 130, 364, 402, 422, 605
HpyCH4III ACNGT 2 cut(s) 186, 872
HpyCH4IV ACGT 2 cut(s) 190, 253
HpyCH4V TGCA 7 cut(s) 50, 260, 730, 878, 1047, 1082, 1128
HpyF10VI GCNNNNNNNGC 1 cut(s) 1082
HpyF3I CTNAG 5 cut(s) 88, 273, 562, 897, 1380
HpySE526I ACGT 2 cut(s) 190, 253
HspAI GCGC 1 cut(s) 1169
Ksp22I TGATCA 2 cut(s) 343, 1032
Kzo9I GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
LmnI GCTCC 4 cut(s) 54, 84, 167, 542
Lsp1109I GCAGC 5 cut(s) 244, 557, 638, 1031, 1094
LweI GCATC 3 cut(s) 364, 717, 994
MaeI CTAG 2 cut(s) 197, 623
MaeII ACGT 2 cut(s) 190, 253
MaeIII GTNAC 3 cut(s) 173, 186, 949
MalI GATC 6 cut(s) 247, 345, 363, 654, 1034, 1302
MboI GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
MboII GAAGA 5 cut(s) 221, 573, 847, 947, 978
MflI RGATCY 1 cut(s) 361
MhlI GDGCHC 2 cut(s) 1060, 1178
MluCI AATT 7 cut(s) 156, 161, 299, 313, 321, 969, 1318
MlyI GAGTC 3 cut(s) 576, 1097, 1250
MmeI TCCRAC 1 cut(s) 399
Mph1103I ATGCAT 1 cut(s) 732
MslI CAYNNNNRTG 3 cut(s) 453, 735, 1181
MspI CCGG 2 cut(s) 133, 550
MspR9I CCNGG 6 cut(s) 125, 405, 550, 551, 1197, 1206
MvaI CCWGG 4 cut(s) 125, 405, 1197, 1206
MwoI GCNNNNNNNGC 1 cut(s) 1082
NciI CCSGG 2 cut(s) 550, 551
NcoI CCATGG 3 cut(s) 448, 826, 1103
NdeII GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
NlaIV GGNNCC 7 cut(s) 824, 1059, 1101, 1238, 1293, 1307, 1328
NmuCI GTSAC 2 cut(s) 173, 949
NsbI TGCGCA 1 cut(s) 1170
NsiI ATGCAT 1 cut(s) 732
NspI RCATGY 2 cut(s) 332, 1082
OliI CACNNNNGTG 1 cut(s) 1181
PagI TCATGA 1 cut(s) 960
PflMI CCANNNNNTGG 1 cut(s) 1356
PkrI GCNGC 5 cut(s) 259, 547, 628, 1046, 1084
PleI GAGTC 3 cut(s) 575, 1096, 1250
PmaCI CACGTG 1 cut(s) 254
PmlI CACGTG 1 cut(s) 254
PpsI GAGTC 3 cut(s) 575, 1096, 1250
Ppu21I YACGTR 2 cut(s) 191, 254
Psp6I CCWGG 4 cut(s) 123, 403, 1195, 1204
PspCI CACGTG 1 cut(s) 254
PspFI CCCAGC 1 cut(s) 997
PspGI CCWGG 4 cut(s) 123, 403, 1195, 1204
PspN4I GGNNCC 7 cut(s) 824, 1059, 1101, 1238, 1293, 1307, 1328
PspPI GGNCC 7 cut(s) 515, 794, 822, 923, 1100, 1292, 1305
PsuI RGATCY 1 cut(s) 361
RsaI GTAC 1 cut(s) 621
RsaNI GTAC 1 cut(s) 620
RseI CAYNNNNRTG 3 cut(s) 453, 735, 1181
SatI GCNGC 5 cut(s) 258, 546, 627, 1045, 1083
Sau3AI GATC 6 cut(s) 245, 343, 361, 652, 1032, 1300
Sau96I GGNCC 7 cut(s) 515, 794, 822, 923, 1100, 1292, 1305
SchI GAGTC 3 cut(s) 576, 1097, 1250
ScrFI CCNGG 6 cut(s) 125, 405, 550, 551, 1197, 1206
SduI GDGCHC 2 cut(s) 1060, 1178
SfaNI GCATC 3 cut(s) 364, 717, 994
SfcI CTRYAG 2 cut(s) 357, 811
SinI GGWCC 2 cut(s) 794, 923
SmaI CCCGGG 1 cut(s) 551
SmiMI CAYNNNNRTG 3 cut(s) 453, 735, 1181
SmlI CTYRAG 3 cut(s) 674, 1249, 1258
SmoI CTYRAG 3 cut(s) 674, 1249, 1258
Sse9I AATT 7 cut(s) 156, 161, 299, 313, 321, 969, 1318
SsiI CCGC 2 cut(s) 377, 1242
SspMI CTAG 2 cut(s) 197, 623
StyD4I CCNGG 6 cut(s) 123, 403, 548, 549, 1195, 1204
StyI CCWWGG 4 cut(s) 448, 585, 826, 1103
TaaI ACNGT 2 cut(s) 186, 872
TaiI ACGT 2 cut(s) 193, 256
TaqI TCGA 3 cut(s) 294, 988, 1150
TasI AATT 7 cut(s) 156, 161, 299, 313, 321, 969, 1318
TatI WGTACW 1 cut(s) 619
TscAI CASTG 2 cut(s) 784, 1077
TseFI GTSAC 2 cut(s) 173, 949
TseI GCWGC 5 cut(s) 257, 545, 626, 1044, 1082
Tsp45I GTSAC 2 cut(s) 173, 949
TspDTI ATGAA 8 cut(s) 101, 312, 383, 486, 624, 1080, 1200, 1210
TspGWI ACGGA 1 cut(s) 29
TspMI CCCGGG 1 cut(s) 549
TspRI CASTG 2 cut(s) 784, 1077
Van91I CCANNNNNTGG 1 cut(s) 1356
VpaK11BI GGWCC 2 cut(s) 794, 923
XapI RAATTY 5 cut(s) 156, 299, 313, 321, 969
XceI RCATGY 2 cut(s) 332, 1082
XmaI CCCGGG 1 cut(s) 549
XmiI GTMKAC 1 cut(s) 100
XspI CTAG 2 cut(s) 197, 623
Zsp2I ATGCAT 1 cut(s) 732
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.