Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001536.1

Orthogroup ID

OG0004069

Physical Location & Seq

Genomic Coordinates Reverse (-)

52126 .. 59262

Gene Structure 7137 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001536.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2838 bp

atgcatcacgctccggcgacggtcgaggaacagttgctgctgaaagcaatcaaggaagaatgcccctgggagagtctaccgaaacggctccaagcgacgctgtcttcgaaagaagaatggcacagatgggtgattgagcattgcataaagaaaagactgcaatggagcagttgctttgctcgaaaaatgtgcaaggaaagtgaatattatgaagacatgatgcggtacttgcgaaggaatctagcgctgtttccctatcaccttgcagagtatgtttgtcgtgtaatgagggtatcacctttccgatactactgcgatatgattttcgaagttatgaaaaatgagcaaccgtatgatagcatccccaattttagtgctgcagatgccttgagactgacagggatcggaagaaatgaatttattgatataatgaacaagtgcagatctaagaaaattatgtggaagctgaacaagtcaattgcaaaggaacttttacctacacaacctgtggattttgctattgaaccgtggcttgaaggatttgtttccaacagagagcaatcttatgaagatcctatagaggagatactatatgcagtatttgttgtttcaagtgagaatgcaactgtcgctgagctggcatcaacattacaggctgaccttgcacagctgcaggctgctgcatcttttgcatgtcgattgggatgggccgtaaaagtatttgacccagcatctgttcttcaagatgcaggtttaccaggatctcctagaaacagtcttagtgatgaagatccatctcatcgtagtacgggctcaaggaatatgtttgctgatggtgatgctactatacaaggtgatgcttcagggagagaaaactatgggccagtttcttcgcaggatcgtgttgcatttgttgttgatgctaacataacatcttatcttatgatggggtctgtttcaccaggtctgaaatctcatgctgtgacgctatacgaagcgggaaagttgggtcatgctagcattacagatctttgcaaggatcttagtacgctagagggcaccaaatttgaaggagaactgcaggaatttgcaaatcatgcatttagcctccgttgtgttttggaatgccttcaatcaggaggagttgcaactgatgtgaaagctgatgaagtttgcaatatgaaggatatgataaatttcaatgatgatgaggctgcgatcatacctaacatccctctgactaaccaatcaggagaccttagtacgcatgaagacgcaattgatgatgatggttctaagaaatcagggatgccccaggacagttccgttttggtcgaacatgttaataatattacaagtgaggaagtaatgattggtacttcatcagaagatacaacttgcttaaatgaagtctctaaatcagattctaatcttcaaagttgtgagaaactgatgcctgatgaaggttcagatgttggaggagaactgtttaagaggaaaaagaaattccgagtggatatccttcgctgtgaaagcttggcgtcccttgcaccagccactttagatcggttgcttcgtcgtgactatgatattgttgtgtctatggttcctcttccgccgtcgtcagtacttcctggacctacaggtcctattaattttggtcctccctcttattcatcaatgactccttggatgaaaatagtattgtactcaactttgggctgtggacctctatcggttattctgatgaagggacaatgcttacgcttacttcctgcaccactagctggttgtgaaaaagcccttttatggtcttgggatggttctacagttggagggttgggaggcaagtttgaaggaaatctagtaaagggaaatatacttctacattgcttaaattcaattcttaaattctctgctgtactagtgcagcccctcagtaggtatgacctcgatgaatcaggaaaaattgttactatggatattccattaccgctgaagaactctgatggttcaattgaatgtatggggaaggaattgggactgtctgaaaaggaagcttcagaactggattctatgttgactgctttggcaaacaagatagaattgtggacagttggctatattcgcgtattgaaacttttcagagaaagagattcagaccactttgcacctgatgatgagaagtatgaatgggtcccgttaagtgtggaatttgggatgccactatttaatccaaaattgtgcaataatatttgcaaaagagtggtatcatcacaattacttcaaaatgatttatttaccaagcatcatgatgcaatgcaaggcttacggaaaatgttacgtgatgtttgtacagagtaccaagcaacaggtgctgccgcaaaacttctttaccagaaagagcaaccaaaggacttctcacggcatctcatgaattatgcgagcggaaggtggaatcctcttatagacccttcttctccgatttcaggagcctcgagtgatcatcagagactaaaactagttagtcgacatcgttcccgaactgaagttttgagctttgatggaagcattctaagatcatatgctctatctcctgtttatgaggctgccacaaggccagtagaagaatccacttcagtgagcactccaaaagttgagcaagaagaatctgacagcaaagacgttgtccttcctggtgttaatcttctttttgatggctcagagttgcacccctttgagataggtgcttgtctacaggctcggcaaccagtctcattaatagcagaggcagctgctgcctctgcatctctgcaacaaactagggcttcatcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAM91_C FAM91_N

Protein Analysis

945

Amino Acids

104.69

Weight (kDa)

5.25

Isoelectric Point (pI)

57.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004069)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G35220 AT1G35220 AT1G35220 AT1G35220 AT1G35220 AT1G35220 AT1G35220
fragaria_vesca	FvH4_5g36450 FvH4_5g36450 FvH4_5g36450 FvH4_5g36450 FvH4_5g36450 FvH4_5g36450 FvH4_5g36450
malus_domestica	MD08G1188800.v1.1 MD15G1376600.v1.1 MD15G1376700.v1.1
prunus_persica	Prupe.1G523400_v2.0.a1
pyrus_communis	pycom08g16250
rosa_chinensis	RchiOBHm_Chr7g0238491
rosa_laevigata	RLG00000000910
rosa_multiflora	Rmu_sc0001536.1_g000012 Rmu_sc0025040.1_g000006
rosa_roxburghii	Rroxscaffold_3G00223010 Rroxscaffold_3G00223110
rosa_rugosa	Rorug07G0312600 Rorug07G0312700 Rorug07G0312800
rosa_samantha	Rh7AG467600 Rh7BG438300 Rh7CG485600 Rh7DG454100
rosa_wichuraiana	Rw7G038830

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1644
Acc36I	ACCTGC	1 cut(s)	740
AccB1I	GGYRCC	1 cut(s)	1058
AccB7I	CCANNNNNTGG	1 cut(s)	1787
AccBSI	CCGCTC	1 cut(s)	2448
AccI	GTMKAC	3 cut(s)	76, 2530, 2755
AccII	CGCG	1 cut(s)	2130
AciI	CCGC	6 cut(s)	223, 998, 1616, 1994, 2382, 2448
AclWI	GGATC	6 cut(s)	410, 566, 769, 785, 906, 1047
AcsI	RAATTY	8 cut(s)	416, 1064, 1085, 1195, 1505, 1897, 1910, 2213
AcuI	CTGAAG	5 cut(s)	846, 2018, 2046, 2568, 2622
AcyI	GRCGYC	1 cut(s)	1541
AfeI	AGCGCT	1 cut(s)	246
AfiI	CCNNNNNNNGG	5 cut(s)	1463, 1787, 1809, 1941, 2489
AflIII	ACRYGT	1 cut(s)	1339
AhlI	ACTAGT	2 cut(s)	1924, 2521
AjnI	CCWGG	6 cut(s)	65, 757, 961, 1314, 1633, 2695
AjuI	GAANNNNNNNTTGG	2 cut(s)	1356, 1388
AleI	CACNNNNGTG	1 cut(s)	2639
AluBI	AGCT	9 cut(s)	466, 637, 670, 1163, 1536, 1787, 2060, 2559, 2795
AluI	AGCT	9 cut(s)	466, 637, 670, 1163, 1536, 1787, 2060, 2559, 2795
Alw21I	GWGCWC	1 cut(s)	2648
Alw26I	GTCTC	5 cut(s)	385, 1248, 1417, 2506, 2779
AlwI	GGATC	6 cut(s)	410, 566, 769, 785, 906, 1047
AlwNI	CAGNNNCTG	4 cut(s)	37, 734, 2378, 2798
Ama87I	CYCGRG	1 cut(s)	2497
Aor51HI	AGCGCT	1 cut(s)	246
AoxI	GGCC	3 cut(s)	708, 881, 2618
ApoI	RAATTY	8 cut(s)	416, 1064, 1085, 1195, 1505, 1897, 1910, 2213
ArsI	GACNNNNNNTTYG	4 cut(s)	88, 120, 2673, 2705
AseI	ATTAAT	2 cut(s)	1653, 2780
Asp700I	GAANNNNTTC	2 cut(s)	1128, 2141
AspLEI	GCGC	1 cut(s)	247
AspS9I	GGNCC	7 cut(s)	708, 881, 1637, 1646, 1661, 1727, 2197
AsuHPI	GGTGA	6 cut(s)	142, 251, 288, 848, 866, 951
AsuII	TTCGAA	2 cut(s)	107, 327
AsuNHI	GCTAGC	1 cut(s)	1016
AvaI	CYCGRG	1 cut(s)	2497
AvaII	GGWCC	5 cut(s)	1637, 1646, 1661, 1727, 2197
BaeGI	GKGCMC	1 cut(s)	1061
BanI	GGYRCC	1 cut(s)	1058
BanII	GRGCYC	1 cut(s)	815
BbsI	GAAGAC	3 cut(s)	96, 219, 1278
Bbv12I	GWGCWC	1 cut(s)	2648
BceAI	ACGGC	4 cut(s)	101, 695, 1603, 2441
BcgI	CGANNNNNNTGC	4 cut(s)	171, 205, 294, 328
BciT130I	CCWGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
BclI	TGATCA	1 cut(s)	2503
BcoDI	GTCTC	5 cut(s)	385, 1248, 1417, 2506, 2779
BcuI	ACTAGT	2 cut(s)	1924, 2521
BfmI	CTRYAG	7 cut(s)	378, 576, 671, 1079, 1641, 1827, 2756
BfoI	RGCGCY	1 cut(s)	248
BfuAI	ACCTGC	1 cut(s)	740
BglII	AGATCT	2 cut(s)	443, 1027
BlpI	GCTNAGC	1 cut(s)	633
BmcAI	AGTACT	1 cut(s)	1629
Bme1390I	CCNGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
Bme18I	GGWCC	5 cut(s)	1637, 1646, 1661, 1727, 2197
BmeT110I	CYCGRG	1 cut(s)	2497
BmgT120I	GGNCC	7 cut(s)	708, 881, 1637, 1646, 1661, 1727, 2197
BmiI	GGNNCC	6 cut(s)	89, 1060, 1608, 2198, 2199, 2494
BmrFI	CCNGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
BmtI	GCTAGC	1 cut(s)	1020
BpiI	GAAGAC	3 cut(s)	96, 219, 1278
Bpu1102I	GCTNAGC	1 cut(s)	633
Bpu14I	TTCGAA	2 cut(s)	107, 327
BpuEI	CTTGAG	2 cut(s)	409, 799
BsaAI	YACGTR	1 cut(s)	2345
BsaBI	GATNNNNATC	2 cut(s)	789, 1428
BsaHI	GRCGYC	1 cut(s)	1541
BsaI	GGTCTC	1 cut(s)	1248
BsaJI	CCNNGG	5 cut(s)	65, 66, 527, 1314, 1688
Bsc4I	CCNNNNNNNGG	5 cut(s)	1463, 1787, 1809, 1941, 2489
Bse1I	ACTGG	4 cut(s)	884, 2073, 2621, 2771
Bse3DI	GCAATG	4 cut(s)	139, 167, 1888, 2325
Bse8I	GATNNNNATC	2 cut(s)	789, 1428
BseBI	CCWGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
BseDI	CCNNGG	5 cut(s)	65, 66, 527, 1314, 1688
BseGI	GGATG	8 cut(s)	360, 710, 1230, 1314, 1698, 1825, 2226, 2831
BseJI	GATNNNNATC	2 cut(s)	789, 1428
BseLI	CCNNNNNNNGG	5 cut(s)	1463, 1787, 1809, 1941, 2489
BseMI	GCAATG	4 cut(s)	139, 167, 1888, 2325
BseMII	CTCAG	3 cut(s)	624, 1951, 2736
BseNI	ACTGG	4 cut(s)	884, 2073, 2621, 2771
BseRI	GAGGAG	3 cut(s)	596, 1155, 1494
BseSI	GKGCMC	1 cut(s)	1061
BseYI	CCCAGC	1 cut(s)	727
BsgI	GTGCAG	3 cut(s)	460, 1761, 1949
Bsh1236I	CGCG	1 cut(s)	2130
Bsh1285I	CGRYCG	1 cut(s)	24
BshFI	GGCC	3 cut(s)	710, 883, 2620
BshNI	GGYRCC	1 cut(s)	1058
BsiEI	CGRYCG	1 cut(s)	24
BsiHKAI	GWGCWC	1 cut(s)	2648
BsiHKCI	CYCGRG	1 cut(s)	2497
BsiSI	CCGG	1 cut(s)	14
BslFI	GGGAC	4 cut(s)	1528, 1767, 2055, 2183
BslI	CCNNNNNNNGG	5 cut(s)	1463, 1787, 1809, 1941, 2489
BsmAI	GTCTC	5 cut(s)	385, 1248, 1417, 2506, 2779
BsmFI	GGGAC	4 cut(s)	1528, 1767, 2055, 2183
BsmI	GAATGC	4 cut(s)	65, 625, 1130, 2571
BsnI	GGCC	3 cut(s)	710, 883, 2620
Bso31I	GGTCTC	1 cut(s)	1248
BsoBI	CYCGRG	1 cut(s)	2497
Bsp119I	TTCGAA	2 cut(s)	107, 327
Bsp1286I	GDGCHC	3 cut(s)	815, 1061, 2648
Bsp1407I	TGTACA	1 cut(s)	2354
Bsp1720I	GCTNAGC	1 cut(s)	633
BspACI	CCGC	6 cut(s)	223, 998, 1616, 1994, 2382, 2448
BspANI	GGCC	3 cut(s)	710, 883, 2620
BspCNI	CTCAG	3 cut(s)	625, 1950, 2735
BspFNI	CGCG	1 cut(s)	2130
BspHI	TCATGA	2 cut(s)	2311, 2433
BspLI	GGNNCC	6 cut(s)	89, 1060, 1608, 2198, 2199, 2494
BspMAI	CTGCAG	3 cut(s)	382, 675, 1083
BspMI	ACCTGC	1 cut(s)	740
BspOI	GCTAGC	1 cut(s)	1020
BspPI	GGATC	6 cut(s)	410, 566, 769, 785, 906, 1047
BspT104I	TTCGAA	2 cut(s)	107, 327
BspT107I	GGYRCC	1 cut(s)	1058
BspTNI	GGTCTC	1 cut(s)	1248
BsrBI	CCGCTC	1 cut(s)	2448
BsrDI	GCAATG	4 cut(s)	139, 167, 1888, 2325
BsrGI	TGTACA	1 cut(s)	2354
BsrI	ACTGG	4 cut(s)	884, 2073, 2621, 2771
BssECI	CCNNGG	5 cut(s)	65, 66, 527, 1314, 1688
BssNI	GRCGYC	1 cut(s)	1541
BssT1I	CCWWGG	1 cut(s)	1688
Bst2UI	CCWGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
Bst6I	CTCTTC	1 cut(s)	1617
BstACI	GRCGYC	1 cut(s)	1541
BstAPI	GCANNNNNTGC	4 cut(s)	689, 1097, 2375, 2798
BstAUI	TGTACA	1 cut(s)	2354
BstBAI	YACGTR	1 cut(s)	2345
BstBI	TTCGAA	2 cut(s)	107, 327
BstC8I	GCNNGC	4 cut(s)	639, 675, 1018, 2446
BstDEI	CTNAG	9 cut(s)	447, 633, 779, 1043, 1259, 1296, 1937, 2576, 2722
BstDSI	CCRYGG	1 cut(s)	527
BstENI	CCTNNNNNAGG	1 cut(s)	1461
BstF5I	GGATG	8 cut(s)	360, 710, 1230, 1314, 1698, 1825, 2226, 2831
BstFNI	CGCG	1 cut(s)	2130
BstH2I	RGCGCY	1 cut(s)	248
BstHHI	GCGC	1 cut(s)	247
BstMAI	GTCTC	5 cut(s)	385, 1248, 1417, 2506, 2779
BstMCI	CGRYCG	1 cut(s)	24
BstNI	CCWGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
BstNSI	RCATGY	2 cut(s)	696, 1343
BstSCI	CCNGG	6 cut(s)	65, 757, 961, 1314, 1633, 2695
BstSFI	CTRYAG	7 cut(s)	378, 576, 671, 1079, 1641, 1827, 2756
BstSLI	GKGCMC	1 cut(s)	1061
BstUI	CGCG	1 cut(s)	2130
BstV2I	GAAGAC	3 cut(s)	96, 219, 1278
BstX2I	RGATCY	6 cut(s)	443, 571, 761, 790, 1027, 1039
BstYI	RGATCY	6 cut(s)	443, 571, 761, 790, 1027, 1039
BsuRI	GGCC	3 cut(s)	710, 883, 2620
BtgI	CCRYGG	1 cut(s)	527
BtsCI	GGATG	8 cut(s)	360, 710, 1230, 1314, 1698, 1825, 2226, 2831
BtsIMutI	CAGTG	1 cut(s)	2646
BveI	ACCTGC	1 cut(s)	740
Cac8I	GCNNGC	4 cut(s)	639, 675, 1018, 2446
CaiI	CAGNNNCTG	4 cut(s)	37, 734, 2378, 2798
CciI	TCATGA	2 cut(s)	2311, 2433
CfoI	GCGC	1 cut(s)	247
Cfr13I	GGNCC	7 cut(s)	708, 881, 1637, 1646, 1661, 1727, 2197
CseI	GACGC	4 cut(s)	106, 994, 1283, 1530
CsiI	ACCWGGT	1 cut(s)	961
CviAII	CATG	9 cut(s)	217, 693, 977, 1013, 1097, 1268, 1340, 2312, 2434
DdeI	CTNAG	9 cut(s)	447, 633, 779, 1043, 1259, 1296, 1937, 2576, 2722
DrdI	GACNNNNNNGTC	1 cut(s)	1644
DseDI	GACNNNNNNGTC	1 cut(s)	1644
Eam1104I	CTCTTC	1 cut(s)	1617
EarI	CTCTTC	1 cut(s)	1617
EciI	GGCGGA	1 cut(s)	1605
Eco130I	CCWWGG	1 cut(s)	1688
Eco24I	GRGCYC	1 cut(s)	815
Eco31I	GGTCTC	1 cut(s)	1248
Eco32I	GATATC	1 cut(s)	1519
Eco47I	GGWCC	5 cut(s)	1637, 1646, 1661, 1727, 2197
Eco47III	AGCGCT	1 cut(s)	246
Eco57I	CTGAAG	5 cut(s)	846, 2018, 2046, 2568, 2622
Eco88I	CYCGRG	1 cut(s)	2497
EcoNI	CCTNNNNNAGG	1 cut(s)	1461
EcoO109I	RGGNCCY	2 cut(s)	1646, 2197
EcoRII	CCWGG	6 cut(s)	65, 757, 961, 1314, 1633, 2695
EcoRV	GATATC	1 cut(s)	1519
EcoT14I	CCWWGG	1 cut(s)	1688
EcoT22I	ATGCAT	2 cut(s)	6, 1102
EcoT38I	GRGCYC	1 cut(s)	815
ErhI	CCWWGG	1 cut(s)	1688
FaeI	CATG	9 cut(s)	220, 696, 980, 1016, 1100, 1271, 1343, 2315, 2437
FaqI	GGGAC	4 cut(s)	1528, 1767, 2055, 2183
FatI	CATG	9 cut(s)	216, 692, 976, 1012, 1096, 1267, 1339, 2311, 2433
FauI	CCCGC	1 cut(s)	991
FauNDI	CATATG	1 cut(s)	2584
FbaI	TGATCA	1 cut(s)	2503
FblI	GTMKAC	3 cut(s)	76, 2530, 2755
FokI	GGATG	8 cut(s)	347, 717, 1217, 1321, 1705, 1832, 2233, 2818
FriOI	GRGCYC	1 cut(s)	815
GlaI	GCGC	1 cut(s)	246
GsaI	CCCAGC	1 cut(s)	731
HaeII	RGCGCY	1 cut(s)	248
HaeIII	GGCC	3 cut(s)	710, 883, 2620
HapII	CCGG	1 cut(s)	14
HgaI	GACGC	4 cut(s)	106, 994, 1283, 1530
HhaI	GCGC	1 cut(s)	247
Hin1I	GRCGYC	1 cut(s)	1541
Hin1II	CATG	9 cut(s)	220, 696, 980, 1016, 1100, 1271, 1343, 2315, 2437
Hin6I	GCGC	1 cut(s)	245
HinP1I	GCGC	1 cut(s)	245
HincII	GTYRAC	2 cut(s)	2082, 2531
HindII	GTYRAC	2 cut(s)	2082, 2531
HindIII	AAGCTT	2 cut(s)	1534, 2058
HpaII	CCGG	1 cut(s)	14
HphI	GGTGA	6 cut(s)	142, 251, 288, 848, 866, 951
Hpy166II	GTNNAC	7 cut(s)	77, 755, 1727, 2082, 2112, 2531, 2756
Hpy188III	TCNNGA	9 cut(s)	743, 1137, 1251, 1580, 1962, 2312, 2434, 2490, 2541
Hpy8I	GTNNAC	7 cut(s)	77, 755, 1727, 2082, 2112, 2531, 2756
Hpy99I	CGWCG	4 cut(s)	22, 100, 1581, 1624
HpyCH4IV	ACGT	2 cut(s)	2344, 2685
HpyF3I	CTNAG	9 cut(s)	447, 633, 779, 1043, 1259, 1296, 1937, 2576, 2722
HpySE526I	ACGT	2 cut(s)	2344, 2685
Hsp92I	GRCGYC	1 cut(s)	1541
Hsp92II	CATG	9 cut(s)	220, 696, 980, 1016, 1100, 1271, 1343, 2315, 2437
HspAI	GCGC	1 cut(s)	245
KflI	GGGWCCC	1 cut(s)	2197
Ksp22I	TGATCA	1 cut(s)	2503
LmnI	GCTCC	4 cut(s)	16, 93, 165, 2492
MabI	ACCWGGT	1 cut(s)	961
MaeII	ACGT	2 cut(s)	2344, 2685
MaeIII	GTNAC	4 cut(s)	982, 1580, 1972, 2340
MbiI	CCGCTC	1 cut(s)	2448
MfeI	CAATTG	3 cut(s)	477, 1278, 2016
MflI	RGATCY	6 cut(s)	443, 571, 761, 790, 1027, 1039
MhlI	GDGCHC	3 cut(s)	815, 1061, 2648
MlyI	GAGTC	2 cut(s)	82, 1678
MmeI	TCCRAC	3 cut(s)	573, 1456, 1813
Mph1103I	ATGCAT	2 cut(s)	6, 1102
MroXI	GAANNNNTTC	2 cut(s)	1128, 2141
MslI	CAYNNNNRTG	2 cut(s)	2313, 2639
MspA1I	CMGCKG	3 cut(s)	670, 1996, 2795
MspI	CCGG	1 cut(s)	14
MspR9I	CCNGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
MunI	CAATTG	3 cut(s)	477, 1278, 2016
Mva1269I	GAATGC	4 cut(s)	65, 625, 1130, 2571
MvaI	CCWGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
MvnI	CGCG	1 cut(s)	2130
NdeI	CATATG	1 cut(s)	2584
NheI	GCTAGC	1 cut(s)	1016
NlaIII	CATG	9 cut(s)	220, 696, 980, 1016, 1100, 1271, 1343, 2315, 2437
NlaIV	GGNNCC	6 cut(s)	89, 1060, 1608, 2198, 2199, 2494
NmeAIII	GCCGAG	1 cut(s)	2743
NmuCI	GTSAC	2 cut(s)	982, 1580
NsiI	ATGCAT	2 cut(s)	6, 1102
NspI	RCATGY	2 cut(s)	696, 1343
NspV	TTCGAA	2 cut(s)	107, 327
OliI	CACNNNNGTG	1 cut(s)	2639
PaeR7I	CTCGAG	1 cut(s)	2497
PagI	TCATGA	2 cut(s)	2311, 2433
PasI	CCCWGGG	1 cut(s)	66
PciI	ACATGT	1 cut(s)	1339
PcsI	WCGNNNNNNNCGW	2 cut(s)	104, 1573
PctI	GAATGC	4 cut(s)	65, 625, 1130, 2571
PdmI	GAANNNNTTC	2 cut(s)	1128, 2141
PfeI	GAWTC	8 cut(s)	238, 1424, 1958, 2072, 2156, 2458, 2630, 2669
PflFI	GACNNNGTC	2 cut(s)	100, 2687
PflMI	CCANNNNNTGG	1 cut(s)	1787
PfoI	TCCNGGA	1 cut(s)	1633
PleI	GAGTC	2 cut(s)	81, 1678
PpsI	GAGTC	2 cut(s)	81, 1678
Ppu21I	YACGTR	1 cut(s)	2345
PpuMI	RGGWCCY	2 cut(s)	1646, 2197
PscI	ACATGT	1 cut(s)	1339
PshBI	ATTAAT	2 cut(s)	1653, 2780
Psp5II	RGGWCCY	2 cut(s)	1646, 2197
Psp6I	CCWGG	6 cut(s)	65, 757, 961, 1314, 1633, 2695
PspFI	CCCAGC	1 cut(s)	727
PspGI	CCWGG	6 cut(s)	65, 757, 961, 1314, 1633, 2695
PspN4I	GGNNCC	6 cut(s)	89, 1060, 1608, 2198, 2199, 2494
PspPI	GGNCC	7 cut(s)	708, 881, 1637, 1646, 1661, 1727, 2197
PspPPI	RGGWCCY	2 cut(s)	1646, 2197
PspXI	VCTCGAGB	1 cut(s)	2497
PstI	CTGCAG	3 cut(s)	382, 675, 1083
PstNI	CAGNNNCTG	4 cut(s)	37, 734, 2378, 2798
PsuI	RGATCY	6 cut(s)	443, 571, 761, 790, 1027, 1039
PsyI	GACNNNGTC	2 cut(s)	100, 2687
PvuII	CAGCTG	2 cut(s)	670, 2795
RseI	CAYNNNNRTG	2 cut(s)	2313, 2639
SalI	GTCGAC	1 cut(s)	2529
Sau96I	GGNCC	7 cut(s)	708, 881, 1637, 1646, 1661, 1727, 2197
ScaI	AGTACT	1 cut(s)	1629
SchI	GAGTC	2 cut(s)	82, 1678
ScrFI	CCNGG	6 cut(s)	67, 759, 963, 1316, 1635, 2697
SduI	GDGCHC	3 cut(s)	815, 1061, 2648
SexAI	ACCWGGT	1 cut(s)	961
SfcI	CTRYAG	7 cut(s)	378, 576, 671, 1079, 1641, 1827, 2756
Sfr274I	CTCGAG	1 cut(s)	2497
SfuI	TTCGAA	2 cut(s)	107, 327
SinI	GGWCC	5 cut(s)	1637, 1646, 1661, 1727, 2197
SlaI	CTCGAG	1 cut(s)	2497
SmiMI	CAYNNNNRTG	2 cut(s)	2313, 2639
SmlI	CTYRAG	3 cut(s)	388, 814, 2497
SmoI	CTYRAG	3 cut(s)	388, 814, 2497
SpeI	ACTAGT	2 cut(s)	1924, 2521
SsiI	CCGC	6 cut(s)	223, 998, 1616, 1994, 2382, 2448
SspI	AATATT	3 cut(s)	206, 1351, 2254
StyD4I	CCNGG	6 cut(s)	65, 757, 961, 1314, 1633, 2695
StyI	CCWWGG	1 cut(s)	1688
TaiI	ACGT	2 cut(s)	2347, 2688
TaqI	TCGA	9 cut(s)	24, 107, 181, 327, 697, 1335, 1953, 2498, 2530
TatI	WGTACW	4 cut(s)	1627, 1707, 1921, 2354
TauI	GCSGC	1 cut(s)	2384
TfiI	GAWTC	8 cut(s)	238, 1424, 1958, 2072, 2156, 2458, 2630, 2669
TscAI	CASTG	1 cut(s)	2646
TseFI	GTSAC	2 cut(s)	982, 1580
Tsp45I	GTSAC	2 cut(s)	982, 1580
TspGWI	ACGGA	3 cut(s)	1100, 1315, 2347
TspRI	CASTG	1 cut(s)	2646
Tth111I	GACNNNGTC	2 cut(s)	100, 2687
Van91I	CCANNNNNTGG	1 cut(s)	1787
VpaK11BI	GGWCC	5 cut(s)	1637, 1646, 1661, 1727, 2197
VspI	ATTAAT	2 cut(s)	1653, 2780
XagI	CCTNNNNNAGG	1 cut(s)	1461
XapI	RAATTY	8 cut(s)	416, 1064, 1085, 1195, 1505, 1897, 1910, 2213
XceI	RCATGY	2 cut(s)	696, 1343
XhoI	CTCGAG	1 cut(s)	2497
XmiI	GTMKAC	3 cut(s)	76, 2530, 2755
XmnI	GAANNNNTTC	2 cut(s)	1128, 2141
ZrmI	AGTACT	1 cut(s)	1629
Zsp2I	ATGCAT	2 cut(s)	6, 1102

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.