Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001755.1

Orthogroup ID

OG0010212

Physical Location & Seq

Genomic Coordinates Forward (+)

236263 .. 239990

Gene Structure 3728 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001755.1_g000049.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1944 bp

atggccggtgttgggaacagttgttttagctcagtgttcacagctcctcttgaaaaagatgtgttcttgaagaagatgaagaaatgttcatgcagttgtttaatgggttccaacaactccttgaaattgaacaaagtctattgtggattgccggagagtggaattgaaaagaaacccacaagcagcacagcctcaaattcaaagaaagtggttgaggattacaacacagctatgaaaaggatgatgaggaacccatatgaatatcatcatgatctgggcatgaactacacactgataacggataacttgatcgtgggctcccagcctcagaaaccagaagatatagatcacctgagagaagtagagaatgtggcatacattctaaacttgcagcaggacaatgatgttgaatattggggaattgacttgcagtcgataataaaaagatgtaaagaagtcggaatccgtcatatgaggaggcctgcaaaagattttgatccagattccttgcgaaatggtctaccgaaagcagtttcatcactggaatgggctatacatgagggaaaaggaaaagtgtacgtgcattgcactgctggattgggaagggcccctgctgtggcaatagcttacatgtactggttcctcggaatgaatctgaatgcagcatatgatgcactgacatccaagagaccctgtggacccaataagagagcaatacaaggagccacttatgatctggccaaaaatgatccatggaaggagccctttgagaatcttcctgaatttgcatttgaggatatggcagattgggaaaggaagttgattcaagaccttcaaatcattgttgatcaacatggaagagcaacagtgttgggcacatggcagaggtatttggggtatgccttgccactttccagagtagtaacggccgcgaacggcaccgtcagcctgctggctggcggcacggtctcgggtgacatattctgcacccaaggccgcatggagagccccacattctggctagggatagtcggcttcgtcatcatcgcctactgcctcgtcaaaaacatcaagggcgccatgatctacggcatcgtcttcgtcacggccgtctcgtggttccgtaacacagaagtaacggcgttcccccacactgccgcaggcgacgccgcctacgagtatttcaaaaaagtcttcgacgtacatacgatccaatccacggcgggggccctcagcttcaagagcttcggcaaagggtatttctgggaagccctaattacgttcctctacgtagacatactggacacgacgggtaccctatactccatggcccgtttcgcagggttcatggaccaggacggtaatttcgaaggtcaatacttcgccttcatgtccgacgccacgtcgatcgtggtggggtccttgcttggcacgtcaccggtgacgacgtttatcgagtcatcgacggggataagagaaggcgggaggacgggactgacggcgctgacggctgcgggctactttttctttgcgttattcttcacgccgttattggcttccattccggcttgggcggtgggcccgccgctgatattagtcggcgtgctgatgatgaagtcggtggtggagatagagtgggatgatatgaggcaggcgattccggcgtttgtgactttgatactgatgccgttgacttactcaatagcctatggtttgattggtggcattgggacctttattgttctgcacctgtgggattggagcagagaacttttggtcaagctgggagttttgaaaggtgaacaagaggaagaagaagctgttgggtccaacggggtggtgcatgatcattccaaagaagaccaagcttcaaaagtacttgaggcatgctcaacctttttcgttcaaggaatatttagcttaggtttatactgtagtctgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005345 GO:0006810 GO:0006863 GO:0008150 GO:0015205 GO:0015851 GO:0015853 GO:0015854 GO:0022857 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071705 GO:0072530 GO:1904823

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Xan_ur_permease

Protein Analysis

647

Amino Acids

71.52

Weight (kDa)

5.82

Isoelectric Point (pI)

34.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010212)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G10940
fragaria_vesca	FvH4_7g25650 FvH4_7g25650 FvH4_7g25650 FvH4_7g25650
malus_domestica	MD01G1164000.v1.1 MD07G1231700.v1.1
prunus_persica	Prupe.2G261800_v2.0.a1 Prupe.2G261800_v2.0.a1
pyrus_communis	pycom07g20950
rosa_chinensis	RchiOBHm_Chr1g0371831
rosa_laevigata	RLG00000026940
rosa_multiflora	Rmu_co8313211.1_g000001 Rmu_sc0001755.1_g000049
rosa_roxburghii	Rroxscaffold_4G00285420
rosa_rugosa	Rorug01G0366600
rosa_samantha	Rh1AG376600 Rh1BG339900 Rh1CG352900 Rh1DG370900
rosa_wichuraiana	Rw1G033130

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	1313
AccB1I	GGYRCC	3 cut(s)	938, 1076, 1313
AccB7I	CCANNNNNTGG	1 cut(s)	1017
AccI	GTMKAC	2 cut(s)	520, 1293
AccII	CGCG	1 cut(s)	932
AclWI	GGATC	3 cut(s)	491, 743, 1204
AcoI	YGGCCR	4 cut(s)	3, 738, 927, 1107
AcsI	RAATTY	2 cut(s)	196, 782
AcyI	GRCGYC	3 cut(s)	1077, 1167, 1398
AfaI	GTAC	5 cut(s)	578, 635, 1203, 1315, 1878
AfiI	CCNNNNNNNGG	7 cut(s)	12, 158, 616, 1017, 1116, 1219, 1224
AflIII	ACRYGT	1 cut(s)	630
AgeI	ACCGGT	1 cut(s)	1438
AhdI	GACNNNNNGTC	2 cut(s)	430, 1402
AjiI	CACGTC	2 cut(s)	1404, 1434
AjnI	CCWGG	1 cut(s)	1353
AjuI	GAANNNNNNNTTGG	2 cut(s)	1806, 1838
Alw26I	GTCTC	3 cut(s)	682, 973, 1117
AlwI	GGATC	3 cut(s)	491, 743, 1204
Ama87I	CYCGRG	1 cut(s)	970
ApaI	GGGCCC	3 cut(s)	610, 1231, 1583
ApeKI	GCWGC	4 cut(s)	183, 391, 662, 1511
ApoI	RAATTY	2 cut(s)	196, 782
ArsI	GACNNNNNNTTYG	2 cut(s)	1349, 1381
AsiGI	ACCGGT	1 cut(s)	1438
Asp718I	GGTACC	1 cut(s)	1313
AspLEI	GCGC	2 cut(s)	1079, 1504
AsuHPI	GGTGA	5 cut(s)	341, 986, 1428, 1453, 1811
AsuII	TTCGAA	1 cut(s)	1368
AvaI	CYCGRG	1 cut(s)	970
AvaII	GGWCC	5 cut(s)	698, 1351, 1419, 1731, 1827
BaeGI	GKGCMC	4 cut(s)	610, 878, 1231, 1583
BalI	TGGCCA	1 cut(s)	740
BanI	GGYRCC	3 cut(s)	938, 1076, 1313
BanII	GRGCYC	6 cut(s)	320, 610, 765, 1010, 1231, 1583
BauI	CACGAG	1 cut(s)	1114
BbsI	GAAGAC	3 cut(s)	1090, 1186, 1866
BbvCI	CCTCAGC	1 cut(s)	1232
BbvI	GCAGC	4 cut(s)	195, 403, 674, 1498
BcgI	CGANNNNNNTGC	2 cut(s)	1081, 1115
BciT130I	CCWGG	1 cut(s)	1355
BclI	TGATCA	2 cut(s)	847, 1846
BcoDI	GTCTC	3 cut(s)	682, 973, 1117
BfaI	CTAG	1 cut(s)	1022
BfmI	CTRYAG	2 cut(s)	1933, 1940
BfoI	RGCGCY	2 cut(s)	1080, 1505
BmcAI	AGTACT	1 cut(s)	1878
Bme1390I	CCNGG	1 cut(s)	1355
Bme18I	GGWCC	5 cut(s)	698, 1351, 1419, 1731, 1827
BmeRI	GACNNNNNGTC	2 cut(s)	430, 1402
BmeT110I	CYCGRG	1 cut(s)	970
BmgBI	CACGTC	2 cut(s)	1404, 1434
BmrFI	CCNGG	1 cut(s)	1355
BmsI	GCATC	3 cut(s)	661, 1101, 1674
BpiI	GAAGAC	3 cut(s)	1090, 1186, 1866
BplI	GAGNNNNNCTC	2 cut(s)	1874, 1906
Bpu10I	CCTNAGC	2 cut(s)	1232, 1921
Bpu14I	TTCGAA	1 cut(s)	1368
BpuEI	CTTGAG	1 cut(s)	1901
BsaAI	YACGTR	2 cut(s)	580, 1291
BsaBI	GATNNNNATC	2 cut(s)	345, 495
BsaHI	GRCGYC	3 cut(s)	1077, 1167, 1398
BsaI	GGTCTC	2 cut(s)	682, 973
BsaJI	CCNNGG	5 cut(s)	643, 752, 991, 1218, 1326
BsaWI	WCCGGW	1 cut(s)	1438
BsaXI	ACNNNNNCTCC	2 cut(s)	1619, 1649
Bsc4I	CCNNNNNNNGG	7 cut(s)	12, 158, 616, 1017, 1116, 1219, 1224
Bse118I	RCCGGY	2 cut(s)	5, 1438
Bse1I	ACTGG	3 cut(s)	546, 641, 1305
Bse3DI	GCAATG	1 cut(s)	583
Bse8I	GATNNNNATC	2 cut(s)	345, 495
BseBI	CCWGG	1 cut(s)	1355
BseDI	CCNNGG	5 cut(s)	643, 752, 991, 1218, 1326
BseGI	GGATG	3 cut(s)	246, 680, 1645
BseJI	GATNNNNATC	2 cut(s)	345, 495
BseLI	CCNNNNNNNGG	7 cut(s)	12, 158, 616, 1017, 1116, 1219, 1224
BseMI	GCAATG	1 cut(s)	583
BseMII	CTCAG	4 cut(s)	45, 341, 344, 1246
BseNI	ACTGG	3 cut(s)	546, 641, 1305
BseRI	GAGGAG	2 cut(s)	36, 490
BseSI	GKGCMC	4 cut(s)	610, 878, 1231, 1583
BseX3I	CGGCCG	2 cut(s)	927, 1107
BseXI	GCAGC	4 cut(s)	195, 403, 674, 1498
BseYI	CCCAGC	2 cut(s)	321, 1783
BsgI	GTGCAG	2 cut(s)	970, 1730
Bsh1236I	CGCG	1 cut(s)	932
Bsh1285I	CGRYCG	3 cut(s)	930, 1110, 1410
BshNI	GGYRCC	3 cut(s)	938, 1076, 1313
BshTI	ACCGGT	1 cut(s)	1438
BsiEI	CGRYCG	3 cut(s)	930, 1110, 1410
BsiHKCI	CYCGRG	1 cut(s)	970
BsiSI	CCGG	5 cut(s)	6, 152, 1439, 1565, 1661
BslFI	GGGAC	2 cut(s)	1506, 1744
BslI	CCNNNNNNNGG	7 cut(s)	12, 158, 616, 1017, 1116, 1219, 1224
BsmAI	GTCTC	3 cut(s)	682, 973, 1117
BsmBI	CGTCTC	1 cut(s)	1117
BsmFI	GGGAC	2 cut(s)	1506, 1744
BsmI	GAATGC	1 cut(s)	664
Bso31I	GGTCTC	2 cut(s)	682, 973
BsoBI	CYCGRG	1 cut(s)	970
Bsp119I	TTCGAA	1 cut(s)	1368
Bsp120I	GGGCCC	3 cut(s)	606, 1227, 1579
Bsp1286I	GDGCHC	7 cut(s)	320, 610, 765, 878, 1010, 1231, 1583
Bsp19I	CCATGG	2 cut(s)	752, 1326
BspCNI	CTCAG	4 cut(s)	44, 340, 345, 1245
BspFNI	CGCG	1 cut(s)	932
BspHI	TCATGA	1 cut(s)	268
BspPI	GGATC	3 cut(s)	491, 743, 1204
BspQI	GCTCTTC	1 cut(s)	853
BspT104I	TTCGAA	1 cut(s)	1368
BspT107I	GGYRCC	3 cut(s)	938, 1076, 1313
BspTNI	GGTCTC	2 cut(s)	682, 973
BsrDI	GCAATG	1 cut(s)	583
BsrFI	RCCGGY	2 cut(s)	5, 1438
BsrI	ACTGG	3 cut(s)	546, 641, 1305
BssAI	RCCGGY	2 cut(s)	5, 1438
BssECI	CCNNGG	5 cut(s)	643, 752, 991, 1218, 1326
BssNI	GRCGYC	3 cut(s)	1077, 1167, 1398
BssSI	CACGAG	1 cut(s)	1114
BssT1I	CCWWGG	3 cut(s)	752, 991, 1326
Bst2BI	CACGAG	1 cut(s)	1114
Bst2UI	CCWGG	1 cut(s)	1355
Bst4CI	ACNGT	6 cut(s)	20, 868, 943, 967, 1361, 1934
Bst6I	CTCTTC	1 cut(s)	853
BstACI	GRCGYC	3 cut(s)	1077, 1167, 1398
BstAPI	GCANNNNNTGC	1 cut(s)	671
BstBAI	YACGTR	2 cut(s)	580, 1291
BstBI	TTCGAA	1 cut(s)	1368
BstDEI	CTNAG	5 cut(s)	31, 327, 353, 1232, 1921
BstDSI	CCRYGG	3 cut(s)	752, 1218, 1326
BstF5I	GGATG	3 cut(s)	246, 680, 1645
BstFNI	CGCG	1 cut(s)	932
BstH2I	RGCGCY	2 cut(s)	1080, 1505
BstHHI	GCGC	2 cut(s)	1079, 1504
BstMAI	GTCTC	3 cut(s)	682, 973, 1117
BstMCI	CGRYCG	3 cut(s)	930, 1110, 1410
BstMWI	GCNNNNNNNGC	9 cut(s)	671, 945, 993, 1005, 1166, 1242, 1337, 1508, 1661
BstNI	CCWGG	1 cut(s)	1355
BstNSI	RCATGY	2 cut(s)	634, 1890
BstSCI	CCNGG	1 cut(s)	1353
BstSFI	CTRYAG	2 cut(s)	1933, 1940
BstSLI	GKGCMC	4 cut(s)	610, 878, 1231, 1583
BstSNI	TACGTA	1 cut(s)	1291
BstUI	CGCG	1 cut(s)	932
BstV1I	GCAGC	4 cut(s)	195, 403, 674, 1498
BstV2I	GAAGAC	3 cut(s)	1090, 1186, 1866
BstXI	CCANNNNNNTGG	1 cut(s)	1837
BstZI	CGGCCG	2 cut(s)	927, 1107
BtgI	CCRYGG	3 cut(s)	752, 1218, 1326
BtgZI	GCGATG	1 cut(s)	1030
BtrI	CACGTC	2 cut(s)	1404, 1434
BtsCI	GGATG	3 cut(s)	246, 680, 1645
BtsI	GCAGTG	2 cut(s)	588, 1152
BtsIMutI	CAGTG	7 cut(s)	39, 290, 539, 588, 674, 873, 1152
CciI	TCATGA	1 cut(s)	268
CfoI	GCGC	2 cut(s)	1079, 1504
Cfr10I	RCCGGY	2 cut(s)	5, 1438
CseI	GACGC	2 cut(s)	1175, 1406
Csp6I	GTAC	5 cut(s)	577, 634, 1202, 1314, 1877
CspAI	ACCGGT	1 cut(s)	1438
CspCI	CAANNNNNGTGG	2 cut(s)	189, 224
CviQI	GTAC	5 cut(s)	577, 634, 1202, 1314, 1877
DdeI	CTNAG	5 cut(s)	31, 327, 353, 1232, 1921
DinI	GGCGCC	1 cut(s)	1078
DriI	GACNNNNNGTC	2 cut(s)	430, 1402
EaeI	YGGCCR	4 cut(s)	3, 738, 927, 1107
EagI	CGGCCG	2 cut(s)	927, 1107
Eam1104I	CTCTTC	1 cut(s)	853
Eam1105I	GACNNNNNGTC	2 cut(s)	430, 1402
EarI	CTCTTC	1 cut(s)	853
EclXI	CGGCCG	2 cut(s)	927, 1107
Eco105I	TACGTA	1 cut(s)	1291
Eco130I	CCWWGG	3 cut(s)	752, 991, 1326
Eco147I	AGGCCT	1 cut(s)	481
Eco24I	GRGCYC	6 cut(s)	320, 610, 765, 1010, 1231, 1583
Eco31I	GGTCTC	2 cut(s)	682, 973
Eco47I	GGWCC	5 cut(s)	698, 1351, 1419, 1731, 1827
Eco52I	CGGCCG	2 cut(s)	927, 1107
Eco88I	CYCGRG	1 cut(s)	970
EcoO109I	RGGNCCY	6 cut(s)	606, 607, 1227, 1228, 1419, 1731
EcoRII	CCWGG	1 cut(s)	1353
EcoT14I	CCWWGG	3 cut(s)	752, 991, 1326
EcoT38I	GRGCYC	6 cut(s)	320, 610, 765, 1010, 1231, 1583
EgeI	GGCGCC	1 cut(s)	1078
EheI	GGCGCC	1 cut(s)	1078
ErhI	CCWWGG	3 cut(s)	752, 991, 1326
Esp3I	CGTCTC	1 cut(s)	1117
FalI	AAGNNNNNCTT	2 cut(s)	749, 781
FaqI	GGGAC	2 cut(s)	1506, 1744
FauI	CCCGC	4 cut(s)	1216, 1475, 1507, 1590
FauNDI	CATATG	3 cut(s)	256, 471, 667
FbaI	TGATCA	2 cut(s)	847, 1846
FblI	GTMKAC	2 cut(s)	520, 1293
FokI	GGATG	3 cut(s)	253, 667, 1652
FriOI	GRGCYC	6 cut(s)	320, 610, 765, 1010, 1231, 1583
FspBI	CTAG	1 cut(s)	1022
GlaI	GCGC	2 cut(s)	1078, 1503
GsaI	CCCAGC	2 cut(s)	325, 1787
HaeII	RGCGCY	2 cut(s)	1080, 1505
HapII	CCGG	5 cut(s)	6, 152, 1439, 1565, 1661
HgaI	GACGC	2 cut(s)	1175, 1406
HhaI	GCGC	2 cut(s)	1079, 1504
Hin1I	GRCGYC	3 cut(s)	1077, 1167, 1398
Hin6I	GCGC	2 cut(s)	1077, 1502
HinP1I	GCGC	2 cut(s)	1077, 1502
HincII	GTYRAC	1 cut(s)	1692
HindII	GTYRAC	1 cut(s)	1692
HindIII	AAGCTT	1 cut(s)	1866
HinfI	GANTC	7 cut(s)	462, 503, 652, 772, 823, 1457, 1657
HpaII	CCGG	5 cut(s)	6, 152, 1439, 1565, 1661
HphI	GGTGA	5 cut(s)	341, 986, 1428, 1453, 1811
Hpy166II	GTNNAC	7 cut(s)	39, 521, 577, 698, 1294, 1692, 1802
Hpy188I	TCNGA	5 cut(s)	330, 461, 647, 657, 1396
Hpy188III	TCNNGA	8 cut(s)	50, 67, 269, 500, 779, 827, 915, 1240
Hpy8I	GTNNAC	7 cut(s)	39, 521, 577, 698, 1294, 1692, 1802
Hpy99I	CGWCG	7 cut(s)	1169, 1202, 1312, 1400, 1408, 1450, 1468
HpyAV	CCTTC	6 cut(s)	597, 751, 842, 1364, 1396, 1472
HpyCH4III	ACNGT	6 cut(s)	20, 868, 943, 967, 1361, 1934
HpyCH4IV	ACGT	7 cut(s)	579, 1200, 1280, 1290, 1403, 1433, 1448
HpyF10VI	GCNNNNNNNGC	9 cut(s)	671, 945, 993, 1005, 1166, 1242, 1337, 1508, 1661
HpyF3I	CTNAG	5 cut(s)	31, 327, 353, 1232, 1921
HpySE526I	ACGT	7 cut(s)	579, 1200, 1280, 1290, 1403, 1433, 1448
Hsp92I	GRCGYC	3 cut(s)	1077, 1167, 1398
HspAI	GCGC	2 cut(s)	1077, 1502
KasI	GGCGCC	1 cut(s)	1076
KpnI	GGTACC	1 cut(s)	1317
Ksp22I	TGATCA	2 cut(s)	847, 1846
LguI	GCTCTTC	1 cut(s)	853
LmnI	GCTCC	5 cut(s)	49, 323, 722, 760, 1761
Lsp1109I	GCAGC	4 cut(s)	195, 403, 674, 1498
LweI	GCATC	3 cut(s)	661, 1101, 1674
MaeI	CTAG	1 cut(s)	1022
MaeII	ACGT	7 cut(s)	579, 1200, 1280, 1290, 1403, 1433, 1448
MaeIII	GTNAC	8 cut(s)	922, 974, 1102, 1124, 1135, 1434, 1441, 1669
MhlI	GDGCHC	7 cut(s)	320, 610, 765, 878, 1010, 1231, 1583
MlsI	TGGCCA	1 cut(s)	740
MluCI	AATT	7 cut(s)	125, 162, 196, 420, 782, 1275, 1363
MluNI	TGGCCA	1 cut(s)	740
Mly113I	GGCGCC	1 cut(s)	1077
MlyI	GAGTC	1 cut(s)	1466
MmeI	TCCRAC	4 cut(s)	135, 439, 1419, 1854
Mox20I	TGGCCA	1 cut(s)	740
MscI	TGGCCA	1 cut(s)	740
MseI	TTAA	1 cut(s)	101
MslI	CAYNNNNRTG	2 cut(s)	230, 544
Msp20I	TGGCCA	1 cut(s)	740
MspA1I	CMGCKG	1 cut(s)	1588
MspI	CCGG	5 cut(s)	6, 152, 1439, 1565, 1661
MspR9I	CCNGG	1 cut(s)	1355
Mva1269I	GAATGC	1 cut(s)	664
MvaI	CCWGG	1 cut(s)	1355
MvnI	CGCG	1 cut(s)	932
MwoI	GCNNNNNNNGC	9 cut(s)	671, 945, 993, 1005, 1166, 1242, 1337, 1508, 1661
NarI	GGCGCC	1 cut(s)	1077
NcoI	CCATGG	2 cut(s)	752, 1326
NdeI	CATATG	3 cut(s)	256, 471, 667
NmuCI	GTSAC	5 cut(s)	974, 1102, 1434, 1441, 1669
NspI	RCATGY	2 cut(s)	634, 1890
NspV	TTCGAA	1 cut(s)	1368
PaeI	GCATGC	1 cut(s)	1890
PagI	TCATGA	1 cut(s)	268
PceI	AGGCCT	1 cut(s)	481
PciI	ACATGT	1 cut(s)	630
PciSI	GCTCTTC	1 cut(s)	853
PcsI	WCGNNNNNNNCGW	4 cut(s)	1107, 1112, 1173, 1365
PctI	GAATGC	1 cut(s)	664
PfeI	GAWTC	6 cut(s)	462, 503, 652, 772, 823, 1657
PflMI	CCANNNNNTGG	1 cut(s)	1017
PinAI	ACCGGT	1 cut(s)	1438
Ple19I	CGATCG	1 cut(s)	1410
PleI	GAGTC	1 cut(s)	1465
PluTI	GGCGCC	1 cut(s)	1080
PpsI	GAGTC	1 cut(s)	1465
Ppu21I	YACGTR	2 cut(s)	580, 1291
PpuMI	RGGWCCY	2 cut(s)	1419, 1731
PscI	ACATGT	1 cut(s)	630
Psp5II	RGGWCCY	2 cut(s)	1419, 1731
Psp6I	CCWGG	1 cut(s)	1353
PspFI	CCCAGC	2 cut(s)	321, 1783
PspGI	CCWGG	1 cut(s)	1353
PspOMI	GGGCCC	3 cut(s)	606, 1227, 1579
PspPPI	RGGWCCY	2 cut(s)	1419, 1731
PvuI	CGATCG	1 cut(s)	1410
RsaI	GTAC	5 cut(s)	578, 635, 1203, 1315, 1878
RsaNI	GTAC	5 cut(s)	577, 634, 1202, 1314, 1877
RseI	CAYNNNNRTG	2 cut(s)	230, 544
SapI	GCTCTTC	1 cut(s)	853
SaqAI	TTAA	1 cut(s)	101
ScaI	AGTACT	1 cut(s)	1878
SchI	GAGTC	1 cut(s)	1466
ScrFI	CCNGG	1 cut(s)	1355
SduI	GDGCHC	7 cut(s)	320, 610, 765, 878, 1010, 1231, 1583
SfaNI	GCATC	3 cut(s)	661, 1101, 1674
SfcI	CTRYAG	2 cut(s)	1933, 1940
SfoI	GGCGCC	1 cut(s)	1078
SfuI	TTCGAA	1 cut(s)	1368
SgrAI	CRCCGGYG	1 cut(s)	1438
SinI	GGWCC	5 cut(s)	698, 1351, 1419, 1731, 1827
SmiMI	CAYNNNNRTG	2 cut(s)	230, 544
SmlI	CTYRAG	1 cut(s)	1880
SmoI	CTYRAG	1 cut(s)	1880
SnaBI	TACGTA	1 cut(s)	1291
SphI	GCATGC	1 cut(s)	1890
Sse9I	AATT	7 cut(s)	125, 162, 196, 420, 782, 1275, 1363
SseBI	AGGCCT	1 cut(s)	481
SspDI	GGCGCC	1 cut(s)	1076
SspI	AATATT	2 cut(s)	413, 1914
SspMI	CTAG	1 cut(s)	1022
StuI	AGGCCT	1 cut(s)	481
StyD4I	CCNGG	1 cut(s)	1353
StyI	CCWWGG	3 cut(s)	752, 991, 1326
TaaI	ACNGT	6 cut(s)	20, 868, 943, 967, 1361, 1934
TaiI	ACGT	7 cut(s)	582, 1203, 1283, 1293, 1406, 1436, 1451
TaqI	TCGA	6 cut(s)	434, 1197, 1368, 1406, 1455, 1463
TasI	AATT	7 cut(s)	125, 162, 196, 420, 782, 1275, 1363
TatI	WGTACW	2 cut(s)	633, 1876
TauI	GCSGC	6 cut(s)	932, 963, 999, 1160, 1172, 1588
TfiI	GAWTC	6 cut(s)	462, 503, 652, 772, 823, 1657
Tru1I	TTAA	1 cut(s)	101
Tru9I	TTAA	1 cut(s)	101
TscAI	CASTG	7 cut(s)	39, 297, 546, 595, 681, 873, 1159
TseFI	GTSAC	5 cut(s)	974, 1102, 1434, 1441, 1669
TseI	GCWGC	4 cut(s)	183, 391, 662, 1511
Tsp45I	GTSAC	5 cut(s)	974, 1102, 1434, 1441, 1669
TspGWI	ACGGA	3 cut(s)	314, 455, 1112
TspRI	CASTG	7 cut(s)	39, 297, 546, 595, 681, 873, 1159
Van91I	CCANNNNNTGG	1 cut(s)	1017
VpaK11BI	GGWCC	5 cut(s)	698, 1351, 1419, 1731, 1827
XapI	RAATTY	2 cut(s)	196, 782
XceI	RCATGY	2 cut(s)	634, 1890
XcmI	CCANNNNNNNNNTGG	2 cut(s)	733, 1408
XmiI	GTMKAC	2 cut(s)	520, 1293
XspI	CTAG	1 cut(s)	1022
ZrmI	AGTACT	1 cut(s)	1878

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.