Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001764.1

Orthogroup ID

OG0008375

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1390

Gene Structure 1390 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001764.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 975 bp

atgtgtaactctgccagtgctgtttcgttttcatcgagttctccaggagagaatcgagtggctgtgaatgtgaggaccaggtcttctagacctcttccttctacattcttgatcagaatggctatgaggatatctagagcaaggtggttcaccttcttgagaagagtgttccactaccaaaatgggtcaaggtctgatcttggatcgaacccttttaattccagcacttggatgatgatggagttcatagttttggtcgttcagataagcatcacgacgattattctggctgtttcggagagggagaagccggtttggcctatgagaatttggattgttgggtatgatataggctgtgttctcaatttgctgctactatttggtcgttacaggctactttatctcactcaagcagatggtttcaacctttcggatatagaacaacaaagaggcgttgaagaatccagggcaacacatttgatgaacaggtgtagaacctcacttgagctgttctttgcaatatggtttgtaatgggtaatgtttgggtgtttgattctcggtttagctcattccctggagccccaaaactccatgtgctctgcattgctctgcttgcttggaatgcaatcagctactcttttccattcctactgtttgtgttgctgtgttgctgtgttcctctgattaacagcatgcttggatacaacatgaacatgggctccattgataaagcagcatctgatgaccaaatctctcagctacctagctggagatataaggaagttaacacctccatagagctagcaaatgatcgcaactcagacctcacaaatgaagatccatatacattcgccattgataaagcagcatctgatgaccaaatctctcagctacctagctggagatataaggaagttaacacctccatagagctgggaaatgatcgcaactcagacctcacaaatgaagatcca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

zf-RING_11 zf-RING_2

Protein Analysis

325

Amino Acids

37.09

Weight (kDa)

6.33

Isoelectric Point (pI)

39.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008375)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G55970 AT5G55970 AT5G55970
fragaria_vesca	FvH4_3g42300 FvH4_3g42300
malus_domestica	MD03G1034800.v1.1 MD11G1036700.v1.1
prunus_persica	Prupe.6G028000_v2.0.a1 Prupe.6G028000_v2.0.a1
pyrus_communis	pycom03g02700 pycom11g03040
rosa_chinensis	RchiOBHm_Chr5g0075651
rosa_laevigata	RLG00000036585
rosa_multiflora	Rmu_sc0001764.1_g000001
rosa_roxburghii	Rroxscaffold_1G00005940 Rroxscaffold_3G00219110
rosa_rugosa	Rorug05G0442000 Rorug05G0442100
rosa_samantha	Rh5AG498400 Rh5BG519300 Rh5CG542900 Rh5DG529900
rosa_wichuraiana	Rw5G046220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	228
AclWI	GGATC	3 cut(s)	211, 833, 965
AcsI	RAATTY	1 cut(s)	327
AfiI	CCNNNNNNNGG	1 cut(s)	228
AgsI	TTSAA	2 cut(s)	424, 458
AjnI	CCWGG	4 cut(s)	43, 77, 464, 574
AloI	GAACNNNNNNTCC	2 cut(s)	704, 736
AluBI	AGCT	9 cut(s)	508, 567, 633, 760, 768, 802, 892, 900, 934
AluI	AGCT	9 cut(s)	508, 567, 633, 760, 768, 802, 892, 900, 934
Alw21I	GWGCWC	1 cut(s)	600
AlwI	GGATC	3 cut(s)	211, 833, 965
AlwNI	CAGNNNCTG	2 cut(s)	740, 872
AoxI	GGCC	1 cut(s)	317
ApeKI	GCWGC	3 cut(s)	370, 734, 866
ApoI	RAATTY	1 cut(s)	327
AspS9I	GGNCC	1 cut(s)	75
AsuHPI	GGTGA	1 cut(s)	142
AsuNHI	GCTAGC	1 cut(s)	802
AvaII	GGWCC	1 cut(s)	75
BanII	GRGCYC	2 cut(s)	583, 722
BbsI	GAAGAC	1 cut(s)	75
Bbv12I	GWGCWC	1 cut(s)	600
BbvI	GCAGC	3 cut(s)	357, 746, 878
BccI	CCATC	2 cut(s)	232, 410
BciT130I	CCWGG	4 cut(s)	45, 79, 466, 576
BciVI	GTATCC	1 cut(s)	695
BclI	TGATCA	1 cut(s)	111
BfaI	CTAG	5 cut(s)	87, 135, 765, 803, 897
BfuI	GTATCC	1 cut(s)	695
BglI	GCCNNNNNGGC	1 cut(s)	316
BisI	GCNGC	3 cut(s)	371, 735, 867
BlsI	GCNGC	3 cut(s)	372, 736, 868
Bme1390I	CCNGG	4 cut(s)	45, 79, 466, 576
Bme18I	GGWCC	1 cut(s)	75
BmgT120I	GGNCC	1 cut(s)	75
BmiI	GGNNCC	2 cut(s)	580, 721
BmrFI	CCNGG	4 cut(s)	45, 79, 466, 576
BmsI	GCATC	3 cut(s)	279, 746, 878
BmtI	GCTAGC	1 cut(s)	806
BpiI	GAAGAC	1 cut(s)	75
BpmI	CTGGAG	4 cut(s)	27, 597, 790, 922
BpuEI	CTTGAG	3 cut(s)	178, 393, 524
BsaBI	GATNNNNATC	1 cut(s)	269
BsaJI	CCNNGG	2 cut(s)	465, 574
BsaXI	ACNNNNNCTCC	2 cut(s)	704, 734
Bsc4I	CCNNNNNNNGG	1 cut(s)	228
Bse118I	RCCGGY	1 cut(s)	310
Bse1I	ACTGG	1 cut(s)	15
Bse3DI	GCAATG	1 cut(s)	603
Bse8I	GATNNNNATC	1 cut(s)	269
BseBI	CCWGG	4 cut(s)	45, 79, 466, 576
BseDI	CCNNGG	2 cut(s)	465, 574
BseGI	GGATG	1 cut(s)	237
BseJI	GATNNNNATC	1 cut(s)	269
BseLI	CCNNNNNNNGG	1 cut(s)	228
BseMI	GCAATG	1 cut(s)	603
BseMII	CTCAG	4 cut(s)	770, 834, 902, 966
BseNI	ACTGG	1 cut(s)	15
BseXI	GCAGC	3 cut(s)	357, 746, 878
BseYI	CCCAGC	1 cut(s)	934
BshFI	GGCC	1 cut(s)	319
BsiHKAI	GWGCWC	1 cut(s)	600
BsiSI	CCGG	1 cut(s)	311
BslI	CCNNNNNNNGG	1 cut(s)	228
BsmI	GAATGC	1 cut(s)	628
BsnI	GGCC	1 cut(s)	319
Bsp1286I	GDGCHC	3 cut(s)	583, 600, 722
Bsp143I	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
BspANI	GGCC	1 cut(s)	319
BspCNI	CTCAG	4 cut(s)	769, 833, 901, 965
BspLI	GGNNCC	2 cut(s)	580, 721
BspOI	GCTAGC	1 cut(s)	806
BspPI	GGATC	3 cut(s)	211, 833, 965
BsrDI	GCAATG	1 cut(s)	603
BsrFI	RCCGGY	1 cut(s)	310
BsrI	ACTGG	1 cut(s)	15
BssAI	RCCGGY	1 cut(s)	310
BssECI	CCNNGG	2 cut(s)	465, 574
BssMI	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
Bst2UI	CCWGG	4 cut(s)	45, 79, 466, 576
Bst4CI	ACNGT	1 cut(s)	654
Bst6I	CTCTTC	2 cut(s)	99, 157
BstC8I	GCNNGC	3 cut(s)	615, 695, 804
BstDEI	CTNAG	4 cut(s)	756, 820, 888, 952
BstF5I	GGATG	1 cut(s)	237
BstKTI	GATC	7 cut(s)	114, 199, 206, 814, 841, 946, 973
BstMBI	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
BstMWI	GCNNNNNNNGC	3 cut(s)	316, 614, 623
BstNI	CCWGG	4 cut(s)	45, 79, 466, 576
BstNSI	RCATGY	1 cut(s)	697
BstSCI	CCNGG	4 cut(s)	43, 77, 464, 574
BstV1I	GCAGC	3 cut(s)	357, 746, 878
BstV2I	GAAGAC	1 cut(s)	75
BstX2I	RGATCY	2 cut(s)	838, 970
BstXI	CCANNNNNNTGG	1 cut(s)	934
BstYI	RGATCY	2 cut(s)	838, 970
BsuI	GTATCC	1 cut(s)	695
BsuRI	GGCC	1 cut(s)	319
BtsCI	GGATG	1 cut(s)	237
BtsIMutI	CAGTG	1 cut(s)	22
Cac8I	GCNNGC	3 cut(s)	615, 695, 804
CaiI	CAGNNNCTG	2 cut(s)	740, 872
Cfr10I	RCCGGY	1 cut(s)	310
Cfr13I	GGNCC	1 cut(s)	75
CsiI	ACCWGGT	1 cut(s)	77
CviAII	CATG	4 cut(s)	593, 694, 709, 715
DdeI	CTNAG	4 cut(s)	756, 820, 888, 952
DpnI	GATC	7 cut(s)	113, 198, 205, 813, 840, 945, 972
DpnII	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
Eam1104I	CTCTTC	2 cut(s)	99, 157
EarI	CTCTTC	2 cut(s)	99, 157
Eco24I	GRGCYC	2 cut(s)	583, 722
Eco32I	GATATC	1 cut(s)	132
Eco47I	GGWCC	1 cut(s)	75
EcoRII	CCWGG	4 cut(s)	43, 77, 464, 574
EcoRV	GATATC	1 cut(s)	132
EcoT38I	GRGCYC	2 cut(s)	583, 722
FaeI	CATG	4 cut(s)	596, 697, 712, 718
FatI	CATG	4 cut(s)	592, 693, 708, 714
FbaI	TGATCA	1 cut(s)	111
Fnu4HI	GCNGC	3 cut(s)	371, 735, 867
FokI	GGATG	1 cut(s)	244
FriOI	GRGCYC	2 cut(s)	583, 722
Fsp4HI	GCNGC	3 cut(s)	371, 735, 867
FspBI	CTAG	5 cut(s)	87, 135, 765, 803, 897
GluI	GCNGC	3 cut(s)	371, 735, 867
GsaI	CCCAGC	1 cut(s)	938
GsuI	CTGGAG	4 cut(s)	27, 597, 790, 922
HaeIII	GGCC	1 cut(s)	319
HapII	CCGG	1 cut(s)	311
Hin1II	CATG	4 cut(s)	596, 697, 712, 718
HincII	GTYRAC	2 cut(s)	787, 919
HindII	GTYRAC	2 cut(s)	787, 919
HinfI	GANTC	3 cut(s)	52, 461, 554
HpaI	GTTAAC	2 cut(s)	787, 919
HpaII	CCGG	1 cut(s)	311
HphI	GGTGA	1 cut(s)	142
Hpy166II	GTNNAC	3 cut(s)	150, 787, 919
Hpy188III	TCNNGA	5 cut(s)	87, 109, 135, 157, 274
Hpy8I	GTNNAC	3 cut(s)	150, 787, 919
Hpy99I	CGWCG	1 cut(s)	280
HpyAV	CCTTC	2 cut(s)	108, 163
HpyCH4III	ACNGT	1 cut(s)	654
HpyCH4V	TGCA	3 cut(s)	518, 603, 626
HpyF10VI	GCNNNNNNNGC	3 cut(s)	316, 614, 623
HpyF3I	CTNAG	4 cut(s)	756, 820, 888, 952
Hsp92II	CATG	4 cut(s)	596, 697, 712, 718
Ksp22I	TGATCA	1 cut(s)	111
KspAI	GTTAAC	2 cut(s)	787, 919
Kzo9I	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
LmnI	GCTCC	2 cut(s)	578, 725
Lsp1109I	GCAGC	3 cut(s)	357, 746, 878
LweI	GCATC	3 cut(s)	279, 746, 878
MabI	ACCWGGT	1 cut(s)	77
MaeI	CTAG	5 cut(s)	87, 135, 765, 803, 897
MaeIII	GTNAC	2 cut(s)	5, 386
MalI	GATC	7 cut(s)	113, 198, 205, 813, 840, 945, 972
MboI	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
MboII	GAAGA	5 cut(s)	75, 86, 174, 470, 848
MflI	RGATCY	2 cut(s)	838, 970
MhlI	GDGCHC	3 cut(s)	583, 600, 722
MluCI	AATT	3 cut(s)	217, 327, 364
MseI	TTAA	4 cut(s)	216, 687, 786, 918
MslI	CAYNNNNRTG	2 cut(s)	230, 713
MspI	CCGG	1 cut(s)	311
MspR9I	CCNGG	4 cut(s)	45, 79, 466, 576
Mva1269I	GAATGC	1 cut(s)	628
MvaI	CCWGG	4 cut(s)	45, 79, 466, 576
MwoI	GCNNNNNNNGC	3 cut(s)	316, 614, 623
NdeII	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
NheI	GCTAGC	1 cut(s)	802
NlaIII	CATG	4 cut(s)	596, 697, 712, 718
NlaIV	GGNNCC	2 cut(s)	580, 721
NspI	RCATGY	1 cut(s)	697
PaeI	GCATGC	1 cut(s)	697
PcsI	WCGNNNNNNNCGW	1 cut(s)	32
PctI	GAATGC	1 cut(s)	628
PfeI	GAWTC	3 cut(s)	52, 461, 554
PflFI	GACNNNGTC	1 cut(s)	79
PflMI	CCANNNNNTGG	1 cut(s)	228
PfoI	TCCNGGA	1 cut(s)	43
PkrI	GCNGC	3 cut(s)	372, 736, 868
Psp6I	CCWGG	4 cut(s)	43, 77, 464, 574
PspFI	CCCAGC	1 cut(s)	934
PspGI	CCWGG	4 cut(s)	43, 77, 464, 574
PspN4I	GGNNCC	2 cut(s)	580, 721
PspPI	GGNCC	1 cut(s)	75
PstNI	CAGNNNCTG	2 cut(s)	740, 872
PsuI	RGATCY	2 cut(s)	838, 970
PsyI	GACNNNGTC	1 cut(s)	79
RseI	CAYNNNNRTG	2 cut(s)	230, 713
SaqAI	TTAA	4 cut(s)	216, 687, 786, 918
SatI	GCNGC	3 cut(s)	371, 735, 867
Sau3AI	GATC	7 cut(s)	111, 196, 203, 811, 838, 943, 970
Sau96I	GGNCC	1 cut(s)	75
ScrFI	CCNGG	4 cut(s)	45, 79, 466, 576
SduI	GDGCHC	3 cut(s)	583, 600, 722
SexAI	ACCWGGT	1 cut(s)	77
SfaNI	GCATC	3 cut(s)	279, 746, 878
SinI	GGWCC	1 cut(s)	75
SmiMI	CAYNNNNRTG	2 cut(s)	230, 713
SmlI	CTYRAG	3 cut(s)	157, 408, 503
SmoI	CTYRAG	3 cut(s)	157, 408, 503
SphI	GCATGC	1 cut(s)	697
Sse9I	AATT	3 cut(s)	217, 327, 364
SspMI	CTAG	5 cut(s)	87, 135, 765, 803, 897
StyD4I	CCNGG	4 cut(s)	43, 77, 464, 574
TaaI	ACNGT	1 cut(s)	654
TaqI	TCGA	3 cut(s)	35, 55, 206
TasI	AATT	3 cut(s)	217, 327, 364
TfiI	GAWTC	3 cut(s)	52, 461, 554
Tru1I	TTAA	4 cut(s)	216, 687, 786, 918
Tru9I	TTAA	4 cut(s)	216, 687, 786, 918
TscAI	CASTG	1 cut(s)	22
TseI	GCWGC	3 cut(s)	370, 734, 866
TspDTI	ATGAA	5 cut(s)	21, 235, 497, 725, 849
TspRI	CASTG	1 cut(s)	22
Tth111I	GACNNNGTC	1 cut(s)	79
Van91I	CCANNNNNTGG	1 cut(s)	228
VpaK11BI	GGWCC	1 cut(s)	75
XapI	RAATTY	1 cut(s)	327
XbaI	TCTAGA	2 cut(s)	86, 134
XceI	RCATGY	1 cut(s)	697
XcmI	CCANNNNNNNNNTGG	1 cut(s)	179
XspI	CTAG	5 cut(s)	87, 135, 765, 803, 897

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.