Rmu_sc0002045.1_g000043

Protein of unknown function (DUF2854)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002045.1
Physical Location & Seq
Reverse (-)
220660 .. 223228
2569 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002045.1_g000043.1.cds

Sequence Viewer

Length: 468 bp
atgttaacatatgggtttcctcttgcaatcattggtatggctttcaagtatgcagaactaaagccggtgccatgcttgacttatttggatgctcagcaattaagggaaacagctgccaccccgattcttatgcaggtcaggaatgatgttacgagataccgctatggggatgagcagcatttggatgaggcgttaaagcgaattttccagtatggtcagggtgggggaattgctcggaggagtgcgcctgttctacaaaggattcgtgaagaggtcacagaagatggtagatactgtttagtcctggtgtttgaggcaaaatctctacagttgtctgattttgaacaaagacaggctaaatttacatcattcttcggaccaggcattacagctgaaattgccaagggagaggagaatttatatgaagtcaaacttatttccaactccaacgtcaaccccactgcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

155

Amino Acids

17.53

Weight (kDa)

5.9

Isoelectric Point (pI)

37.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 124
AccB1I GGYRCC 1 cut(s) 67
AciI CCGC 1 cut(s) 160
AcsI RAATTY 3 cut(s) 201, 359, 415
AfiI CCNNNNNNNGG 1 cut(s) 166
AgsI TTSAA 2 cut(s) 46, 344
AjnI CCWGG 2 cut(s) 303, 379
AluBI AGCT 2 cut(s) 113, 392
AluI AGCT 2 cut(s) 113, 392
ApeKI GCWGC 2 cut(s) 113, 175
ApoI RAATTY 3 cut(s) 201, 359, 415
AspLEI GCGC 1 cut(s) 247
AspS9I GGNCC 1 cut(s) 377
AvaII GGWCC 1 cut(s) 377
BanI GGYRCC 1 cut(s) 67
BbvI GCAGC 2 cut(s) 100, 187
BccI CCATC 1 cut(s) 278
BcgI CGANNNNNNTGC 2 cut(s) 112, 146
BciT130I CCWGG 2 cut(s) 305, 381
BfmI CTRYAG 1 cut(s) 326
BfuAI ACCTGC 1 cut(s) 124
BisI GCNGC 2 cut(s) 114, 176
BlpI GCTNAGC 1 cut(s) 93
BlsI GCNGC 2 cut(s) 115, 177
Bme1390I CCNGG 2 cut(s) 305, 381
Bme18I GGWCC 1 cut(s) 377
BmgT120I GGNCC 1 cut(s) 377
BmiI GGNNCC 1 cut(s) 69
BmrFI CCNGG 2 cut(s) 305, 381
BmsI GCATC 1 cut(s) 79
Bpu1102I GCTNAGC 1 cut(s) 93
BsaJI CCNNGG 1 cut(s) 402
Bsc4I CCNNNNNNNGG 1 cut(s) 166
Bse118I RCCGGY 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 208
BseBI CCWGG 2 cut(s) 305, 381
BseDI CCNNGG 1 cut(s) 402
BseGI GGATG 3 cut(s) 94, 175, 190
BseLI CCNNNNNNNGG 1 cut(s) 166
BseMII CTCAG 1 cut(s) 107
BseNI ACTGG 1 cut(s) 208
BseRI GAGGAG 2 cut(s) 253, 425
BseXI GCAGC 2 cut(s) 100, 187
BshNI GGYRCC 1 cut(s) 67
BsiSI CCGG 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 166
Bsp1720I GCTNAGC 1 cut(s) 93
BspACI CCGC 1 cut(s) 160
BspCNI CTCAG 1 cut(s) 106
BspLI GGNNCC 1 cut(s) 69
BspMI ACCTGC 1 cut(s) 124
BspT107I GGYRCC 1 cut(s) 67
BsrFI RCCGGY 1 cut(s) 64
BsrI ACTGG 1 cut(s) 208
BssAI RCCGGY 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 402
BssT1I CCWWGG 1 cut(s) 402
Bst2UI CCWGG 2 cut(s) 305, 381
Bst4CI ACNGT 2 cut(s) 296, 330
Bst6I CTCTTC 1 cut(s) 264
BstDEI CTNAG 1 cut(s) 93
BstF5I GGATG 3 cut(s) 94, 175, 190
BstHHI GCGC 1 cut(s) 247
BstMWI GCNNNNNNNGC 1 cut(s) 398
BstNI CCWGG 2 cut(s) 305, 381
BstSCI CCNGG 2 cut(s) 303, 379
BstSFI CTRYAG 1 cut(s) 326
BstV1I GCAGC 2 cut(s) 100, 187
BtsCI GGATG 3 cut(s) 94, 175, 190
BtsI GCAGTG 1 cut(s) 459
BtsIMutI CAGTG 1 cut(s) 459
BveI ACCTGC 1 cut(s) 124
CfoI GCGC 1 cut(s) 247
Cfr10I RCCGGY 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 377
CviAII CATG 1 cut(s) 72
CviJI RGCY 5 cut(s) 41, 64, 113, 356, 392
CviKI_1 RGCY 5 cut(s) 41, 64, 113, 356, 392
DdeI CTNAG 1 cut(s) 93
Eam1104I CTCTTC 1 cut(s) 264
EarI CTCTTC 1 cut(s) 264
Eco130I CCWWGG 1 cut(s) 402
Eco47I GGWCC 1 cut(s) 377
EcoRII CCWGG 2 cut(s) 303, 379
EcoT14I CCWWGG 1 cut(s) 402
ErhI CCWWGG 1 cut(s) 402
FaeI CATG 1 cut(s) 75
FalI AAGNNNNNCTT 2 cut(s) 417, 449
FatI CATG 1 cut(s) 71
FauNDI CATATG 1 cut(s) 10
Fnu4HI GCNGC 2 cut(s) 114, 176
FokI GGATG 3 cut(s) 101, 182, 197
Fsp4HI GCNGC 2 cut(s) 114, 176
GlaI GCGC 1 cut(s) 246
GluI GCNGC 2 cut(s) 114, 176
HapII CCGG 1 cut(s) 65
HhaI GCGC 1 cut(s) 247
Hin1II CATG 1 cut(s) 75
Hin6I GCGC 1 cut(s) 245
HinP1I GCGC 1 cut(s) 245
HincII GTYRAC 2 cut(s) 6, 454
HindII GTYRAC 2 cut(s) 6, 454
HinfI GANTC 2 cut(s) 124, 262
HpaI GTTAAC 1 cut(s) 6
HpaII CCGG 1 cut(s) 65
Hpy166II GTNNAC 2 cut(s) 6, 454
Hpy188I TCNGA 3 cut(s) 237, 337, 377
Hpy188III TCNNGA 2 cut(s) 139, 266
Hpy8I GTNNAC 2 cut(s) 6, 454
HpyCH4III ACNGT 2 cut(s) 296, 330
HpyCH4IV ACGT 1 cut(s) 450
HpyCH4V TGCA 4 cut(s) 26, 53, 133, 464
HpyF10VI GCNNNNNNNGC 1 cut(s) 398
HpyF3I CTNAG 1 cut(s) 93
HpySE526I ACGT 1 cut(s) 450
Hsp92II CATG 1 cut(s) 75
HspAI GCGC 1 cut(s) 245
KspAI GTTAAC 1 cut(s) 6
Lsp1109I GCAGC 2 cut(s) 100, 187
LweI GCATC 1 cut(s) 79
MaeII ACGT 1 cut(s) 450
MaeIII GTNAC 2 cut(s) 148, 274
MboII GAAGA 3 cut(s) 281, 293, 364
MluCI AATT 6 cut(s) 98, 201, 228, 359, 396, 415
MmeI TCCRAC 1 cut(s) 465
MnlI CCTC 6 cut(s) 30, 181, 231, 265, 307, 403
MseI TTAA 3 cut(s) 5, 101, 194
MslI CAYNNNNRTG 2 cut(s) 35, 183
MspA1I CMGCKG 2 cut(s) 113, 392
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 305, 381
MvaI CCWGG 2 cut(s) 305, 381
MwoI GCNNNNNNNGC 1 cut(s) 398
NdeI CATATG 1 cut(s) 10
NlaIII CATG 1 cut(s) 75
NlaIV GGNNCC 1 cut(s) 69
NmuCI GTSAC 1 cut(s) 274
PfeI GAWTC 2 cut(s) 124, 262
PkrI GCNGC 2 cut(s) 115, 177
Psp6I CCWGG 2 cut(s) 303, 379
PspGI CCWGG 2 cut(s) 303, 379
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 1 cut(s) 377
PvuII CAGCTG 2 cut(s) 113, 392
RseI CAYNNNNRTG 2 cut(s) 35, 183
SaqAI TTAA 3 cut(s) 5, 101, 194
SatI GCNGC 2 cut(s) 114, 176
Sau96I GGNCC 1 cut(s) 377
ScrFI CCNGG 2 cut(s) 305, 381
SetI ASST 5 cut(s) 115, 138, 276, 394, 453
SfaNI GCATC 1 cut(s) 79
SfcI CTRYAG 1 cut(s) 326
SinI GGWCC 1 cut(s) 377
SmiMI CAYNNNNRTG 2 cut(s) 35, 183
Sse9I AATT 6 cut(s) 98, 201, 228, 359, 396, 415
SsiI CCGC 1 cut(s) 160
StyD4I CCNGG 2 cut(s) 303, 379
StyI CCWWGG 1 cut(s) 402
TaaI ACNGT 2 cut(s) 296, 330
TaiI ACGT 1 cut(s) 453
TasI AATT 6 cut(s) 98, 201, 228, 359, 396, 415
TfiI GAWTC 2 cut(s) 124, 262
Tru1I TTAA 3 cut(s) 5, 101, 194
Tru9I TTAA 3 cut(s) 5, 101, 194
TscAI CASTG 1 cut(s) 466
TseFI GTSAC 1 cut(s) 274
TseI GCWGC 2 cut(s) 113, 175
Tsp45I GTSAC 1 cut(s) 274
TspDTI ATGAA 1 cut(s) 438
TspRI CASTG 1 cut(s) 466
VpaK11BI GGWCC 1 cut(s) 377
XapI RAATTY 3 cut(s) 201, 359, 415
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.