Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002055.1

Orthogroup ID

OG0004725

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1407

Gene Structure 1407 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002055.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 411 bp

atgaagaactgtgaaaggtttctatccgatagcaaaggtataccattgactaaaccagaagacgtccttgttagcggtgctacacaaacaaaatctcctggttcatctacagttttagtcgcttactttgatggtcaggccctccatgtggcgaacattggtaactcaggatttatcataatcagaaatggtgctgtttttaagagatcatctccaatgattcatggcttcaattttccattacaaactgtcagaggcgttgacccctcggaactaatagagagatacagtatagatttggatgagggagatgtcattgtcactgcaacggatggcctttttgacaacttgtatgagcaagaaatcacttcaattgtaactaagtcattccaaaggagaatgagacttcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PP2C SpoIIE

Protein Analysis

137

Amino Acids

15.13

Weight (kDa)

5.64

Isoelectric Point (pI)

41.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004725)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33500
fragaria_vesca	FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930
malus_domestica	MD08G1221000.v1.1 MD15G1411700.v1.1
prunus_persica	Prupe.1G557900_v2.0.a1
pyrus_communis	pycom08g19170 pycom15g36650
rosa_chinensis	RchiOBHm_Chr7g0226241
rosa_laevigata	RLG00000001755
rosa_multiflora	Rmu_sc0002055.1_g000001 Rmu_sc0013267.1_g000003
rosa_roxburghii	Rroxscaffold_3G00233100
rosa_rugosa	Rorug07G0235800 Rorug07G0235900
rosa_samantha	Rh7AG382800 Rh7BG370000 Rh7CG402300 Rh7DG381200
rosa_wichuraiana	Rw0G018620 Rw0G021000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	66
AccI	GTMKAC	1 cut(s)	40
AciI	CCGC	1 cut(s)	75
AcuI	CTGAAG	1 cut(s)	392
AcyI	GRCGYC	1 cut(s)	63
AfiI	CCNNNNNNNGG	1 cut(s)	148
AgsI	TTSAA	2 cut(s)	232, 372
AjnI	CCWGG	1 cut(s)	97
Alw26I	GTCTC	1 cut(s)	397
AoxI	GGCC	2 cut(s)	138, 334
Asp700I	GAANNNNTTC	1 cut(s)	18
AspS9I	GGNCC	1 cut(s)	139
BbsI	GAAGAC	1 cut(s)	66
BccI	CCATC	2 cut(s)	125, 326
BciT130I	CCWGG	1 cut(s)	99
BcoDI	GTCTC	1 cut(s)	397
BfmI	CTRYAG	1 cut(s)	108
Bme1390I	CCNGG	1 cut(s)	99
BmgT120I	GGNCC	1 cut(s)	139
BmrFI	CCNGG	1 cut(s)	99
BpiI	GAAGAC	1 cut(s)	66
BplI	GAGNNNNNCTC	2 cut(s)	196, 228
BsaHI	GRCGYC	1 cut(s)	63
BsaJI	CCNNGG	1 cut(s)	267
BsaXI	ACNNNNNCTCC	2 cut(s)	79, 109
Bsc4I	CCNNNNNNNGG	1 cut(s)	148
BseBI	CCWGG	1 cut(s)	99
BseDI	CCNNGG	1 cut(s)	267
BseGI	GGATG	2 cut(s)	307, 337
BseLI	CCNNNNNNNGG	1 cut(s)	148
BseMII	CTCAG	1 cut(s)	180
BshFI	GGCC	2 cut(s)	140, 336
BslI	CCNNNNNNNGG	1 cut(s)	148
BsmAI	GTCTC	1 cut(s)	397
BsnI	GGCC	2 cut(s)	140, 336
Bsp143I	GATC	1 cut(s)	206
BspACI	CCGC	1 cut(s)	75
BspANI	GGCC	2 cut(s)	140, 336
BspCNI	CTCAG	1 cut(s)	179
BssECI	CCNNGG	1 cut(s)	267
BssMI	GATC	1 cut(s)	206
BssNAI	GTATAC	1 cut(s)	41
BssNI	GRCGYC	1 cut(s)	63
Bst1107I	GTATAC	1 cut(s)	41
Bst2UI	CCWGG	1 cut(s)	99
Bst4CI	ACNGT	4 cut(s)	11, 112, 250, 290
BstACI	GRCGYC	1 cut(s)	63
BstDEI	CTNAG	2 cut(s)	166, 381
BstF5I	GGATG	2 cut(s)	307, 337
BstKTI	GATC	1 cut(s)	209
BstMAI	GTCTC	1 cut(s)	397
BstMBI	GATC	1 cut(s)	206
BstNI	CCWGG	1 cut(s)	99
BstSCI	CCNGG	1 cut(s)	97
BstSFI	CTRYAG	1 cut(s)	108
BstV2I	GAAGAC	1 cut(s)	66
BstZ17I	GTATAC	1 cut(s)	41
BsuRI	GGCC	2 cut(s)	140, 336
BtsCI	GGATG	2 cut(s)	307, 337
BtsI	GCAGTG	1 cut(s)	321
BtsIMutI	CAGTG	1 cut(s)	321
Cfr13I	GGNCC	1 cut(s)	139
CviAII	CATG	2 cut(s)	146, 224
CviJI	RGCY	3 cut(s)	140, 228, 336
CviKI_1	RGCY	3 cut(s)	140, 228, 336
DdeI	CTNAG	2 cut(s)	166, 381
DpnI	GATC	1 cut(s)	208
DpnII	GATC	1 cut(s)	206
Eco57I	CTGAAG	1 cut(s)	392
EcoO109I	RGGNCCY	1 cut(s)	139
EcoRII	CCWGG	1 cut(s)	97
FaeI	CATG	2 cut(s)	149, 227
FaiI	YATR	6 cut(s)	41, 147, 179, 225, 293, 354
FalI	AAGNNNNNCTT	2 cut(s)	51, 83
FatI	CATG	2 cut(s)	145, 223
FblI	GTMKAC	1 cut(s)	40
FokI	GGATG	2 cut(s)	314, 344
HaeIII	GGCC	2 cut(s)	140, 336
Hin1I	GRCGYC	1 cut(s)	63
Hin1II	CATG	2 cut(s)	149, 227
HincII	GTYRAC	1 cut(s)	262
HindII	GTYRAC	1 cut(s)	262
HinfI	GANTC	1 cut(s)	220
Hpy166II	GTNNAC	2 cut(s)	41, 262
Hpy188I	TCNGA	4 cut(s)	28, 185, 254, 271
Hpy188III	TCNNGA	1 cut(s)	168
Hpy8I	GTNNAC	2 cut(s)	41, 262
HpyCH4III	ACNGT	4 cut(s)	11, 112, 250, 290
HpyCH4IV	ACGT	1 cut(s)	63
HpyCH4V	TGCA	1 cut(s)	326
HpyF3I	CTNAG	2 cut(s)	166, 381
HpySE526I	ACGT	1 cut(s)	63
Hsp92I	GRCGYC	1 cut(s)	63
Hsp92II	CATG	2 cut(s)	149, 227
Kzo9I	GATC	1 cut(s)	206
LpnPI	CCDG	5 cut(s)	69, 84, 111, 122, 153
MaeII	ACGT	1 cut(s)	63
MaeIII	GTNAC	3 cut(s)	161, 319, 376
MalI	GATC	1 cut(s)	208
MboI	GATC	1 cut(s)	206
MboII	GAAGA	2 cut(s)	16, 71
MfeI	CAATTG	1 cut(s)	372
MluCI	AATT	2 cut(s)	232, 372
MnlI	CCTC	4 cut(s)	152, 248, 277, 298
MroXI	GAANNNNTTC	1 cut(s)	18
MseI	TTAA	1 cut(s)	201
MspR9I	CCNGG	1 cut(s)	99
MunI	CAATTG	1 cut(s)	372
MvaI	CCWGG	1 cut(s)	99
NdeII	GATC	1 cut(s)	206
NlaIII	CATG	2 cut(s)	149, 227
NmuCI	GTSAC	1 cut(s)	319
PdmI	GAANNNNTTC	1 cut(s)	18
PfeI	GAWTC	1 cut(s)	220
Psp6I	CCWGG	1 cut(s)	97
PspGI	CCWGG	1 cut(s)	97
PspPI	GGNCC	1 cut(s)	139
SaqAI	TTAA	1 cut(s)	201
Sau3AI	GATC	1 cut(s)	206
Sau96I	GGNCC	1 cut(s)	139
ScrFI	CCNGG	1 cut(s)	99
SetI	ASST	3 cut(s)	20, 40, 66
SfcI	CTRYAG	1 cut(s)	108
Sse9I	AATT	2 cut(s)	232, 372
SsiI	CCGC	1 cut(s)	75
StyD4I	CCNGG	1 cut(s)	97
TaaI	ACNGT	4 cut(s)	11, 112, 250, 290
TaiI	ACGT	1 cut(s)	66
TasI	AATT	2 cut(s)	232, 372
TfiI	GAWTC	1 cut(s)	220
Tru1I	TTAA	1 cut(s)	201
Tru9I	TTAA	1 cut(s)	201
TscAI	CASTG	1 cut(s)	328
TseFI	GTSAC	1 cut(s)	319
Tsp45I	GTSAC	1 cut(s)	319
TspDTI	ATGAA	3 cut(s)	17, 93, 212
TspGWI	ACGGA	1 cut(s)	344
TspRI	CASTG	1 cut(s)	328
XmiI	GTMKAC	1 cut(s)	40
XmnI	GAANNNNTTC	1 cut(s)	18
ZraI	GACGTC	1 cut(s)	64

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.