Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0013267.1

Orthogroup ID

OG0004725

Physical Location & Seq

Genomic Coordinates Forward (+)

7324 .. 15678

Gene Structure 8355 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0013267.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1272 bp

atgttcgttttgatttgcgctgtgacagagtgctccgacggtagcgtcgtcttccgatttggcgacgagagcgagaaggctgcttttgatgagattaatagtcgtctggaggatgcggagttgagtgaaggattggttggcgaaagcaatgtggaagaatcggagattgatgcttctccggcgagttcacctgaggagactgccttccttgatttgacctcagcagatgaagtccaaagctcagcagtggcattgacaggtggggaggatgcttgctttgttgcttccggaaactggctaggtgtggctgatggagttagtcaatggtcactggaagggattaatcctgggctatatgcccatgaactcatgaagaactgtgaaaggtttctatccgatagcaaaggtataccattgactaaaccagaagacgtccttgttagcggtgctacgcaaacaaaatctcctggttcatctacagttttagttgcttactttgatggtcaggccctccatgtggcgaacattggtaactcaggatttatcataatcagaaatggtgctgtttttaagagatcatctccaatgattcatggcttcaattttccattacaaactgtcagaggcgttgacccctcggaactaatagagagatacagtatagatttggatgagggagatgtcattgtcactgcaacggatggcctttttgacaacttgtatgagcaagaaatcacttcaattgtaactaagtcattccaaaggagaatgagacttcaggatatagcagagttcttggccgctagcgcactggaggttgggcaatctacttctagaagaagcccatttgcagatgcagttgaggcatctgggtatgtgggatatactgggaggccatcacttcttagaacagagaaaatggaggttggggccctatcagcccaattcaaggagcacaaccttgatttggctagcttagcgcggcatctgctacacggaaggccatcacttcttagaacagagaaaatggaggttggggccctatcagcccaattcaaggagcacagccttgaattggctagcttagcgcggcatctgctacacgctaagaagggtgagagtttccagcaagggttgaggtcagtttcaatggcaaagttgtggatgccatatctacaaaggcctgcaattgaattgccactgatatctttggatcgatactcgaaatcaaaatttcgagcctcgttaataataacgtttgaagatgcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PP2C SpoIIE

Protein Analysis

423

Amino Acids

46.05

Weight (kDa)

4.85

Isoelectric Point (pI)

50.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004725)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G33500
fragaria_vesca	FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930 FvH4_5g30930
malus_domestica	MD08G1221000.v1.1 MD15G1411700.v1.1
prunus_persica	Prupe.1G557900_v2.0.a1
pyrus_communis	pycom08g19170 pycom15g36650
rosa_chinensis	RchiOBHm_Chr7g0226241
rosa_laevigata	RLG00000001755
rosa_multiflora	Rmu_sc0002055.1_g000001 Rmu_sc0013267.1_g000003
rosa_roxburghii	Rroxscaffold_3G00233100
rosa_rugosa	Rorug07G0235800 Rorug07G0235900
rosa_samantha	Rh7AG382800 Rh7BG370000 Rh7CG402300 Rh7DG381200
rosa_wichuraiana	Rw0G018620 Rw0G021000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	44
AatII	GACGTC	1 cut(s)	435
AccI	GTMKAC	1 cut(s)	409
AccII	CGCG	2 cut(s)	982, 1090
AccIII	TCCGGA	1 cut(s)	287
AciI	CCGC	5 cut(s)	116, 444, 801, 982, 1090
AclI	AACGTT	1 cut(s)	1256
AclWI	GGATC	1 cut(s)	1221
AcoI	YGGCCR	1 cut(s)	798
AcsI	RAATTY	1 cut(s)	1232
AcuI	CTGAAG	1 cut(s)	761
AcyI	GRCGYC	1 cut(s)	432
AfiI	CCNNNNNNNGG	6 cut(s)	294, 517, 949, 967, 1057, 1075
AgsI	TTSAA	8 cut(s)	601, 741, 949, 1057, 1073, 1149, 1193, 1262
AjnI	CCWGG	2 cut(s)	346, 466
AjuI	GAANNNNNNNTTGG	2 cut(s)	120, 152
AluBI	AGCT	3 cut(s)	240, 975, 1083
AluI	AGCT	3 cut(s)	240, 975, 1083
Alw21I	GWGCWC	3 cut(s)	35, 957, 1065
Alw26I	GTCTC	2 cut(s)	191, 766
AlwI	GGATC	1 cut(s)	1221
Aor13HI	TCCGGA	1 cut(s)	287
AoxI	GGCC	8 cut(s)	507, 703, 798, 893, 930, 1001, 1038, 1181
ApaI	GGGCCC	2 cut(s)	934, 1042
ApeKI	GCWGC	1 cut(s)	80
ApoI	RAATTY	1 cut(s)	1232
AseI	ATTAAT	2 cut(s)	96, 342
Asp700I	GAANNNNTTC	1 cut(s)	387
AspLEI	GCGC	4 cut(s)	20, 809, 982, 1090
AspS9I	GGNCC	5 cut(s)	508, 930, 931, 1038, 1039
AsuHPI	GGTGA	2 cut(s)	180, 1127
AsuNHI	GCTAGC	3 cut(s)	803, 971, 1079
AxyI	CCTNAGG	1 cut(s)	192
BaeGI	GKGCMC	2 cut(s)	934, 1042
BanII	GRGCYC	2 cut(s)	934, 1042
BbsI	GAAGAC	2 cut(s)	43, 435
Bbv12I	GWGCWC	3 cut(s)	35, 957, 1065
BbvCI	CCTCAGC	1 cut(s)	220
BbvI	GCAGC	1 cut(s)	67
BccI	CCATC	5 cut(s)	305, 494, 695, 904, 1012
BcgI	CGANNNNNNTGC	2 cut(s)	62, 96
BciT130I	CCWGG	2 cut(s)	348, 468
BcoDI	GTCTC	2 cut(s)	191, 766
BfaI	CTAG	5 cut(s)	299, 804, 834, 972, 1080
BfmI	CTRYAG	1 cut(s)	477
BisI	GCNGC	4 cut(s)	81, 801, 983, 1091
BlpI	GCTNAGC	3 cut(s)	241, 976, 1084
BlsI	GCNGC	4 cut(s)	82, 802, 984, 1092
Bme1390I	CCNGG	2 cut(s)	348, 468
BmgT120I	GGNCC	5 cut(s)	508, 930, 931, 1038, 1039
BmiI	GGNNCC	4 cut(s)	931, 932, 1039, 1040
BmrFI	CCNGG	2 cut(s)	348, 468
BmrI	ACTGGG	1 cut(s)	897
BmsI	GCATC	9 cut(s)	103, 160, 259, 844, 875, 994, 1102, 1155, 1255
BmtI	GCTAGC	3 cut(s)	807, 975, 1083
BmuI	ACTGGG	1 cut(s)	897
BpiI	GAAGAC	2 cut(s)	43, 435
BplI	GAGNNNNNCTC	2 cut(s)	565, 597
BpmI	CTGGAG	2 cut(s)	128, 833
Bpu10I	CCTNAGC	1 cut(s)	220
Bpu1102I	GCTNAGC	3 cut(s)	241, 976, 1084
Bsa29I	ATCGAT	1 cut(s)	1216
BsaHI	GRCGYC	1 cut(s)	432
BsaJI	CCNNGG	2 cut(s)	347, 636
BsaWI	WCCGGW	1 cut(s)	287
BsaXI	ACNNNNNCTCC	2 cut(s)	448, 478
Bsc4I	CCNNNNNNNGG	6 cut(s)	294, 517, 949, 967, 1057, 1075
Bse1I	ACTGG	4 cut(s)	299, 336, 816, 892
Bse21I	CCTNAGG	1 cut(s)	192
Bse3DI	GCAATG	1 cut(s)	154
BseAI	TCCGGA	1 cut(s)	287
BseBI	CCWGG	2 cut(s)	348, 468
BseCI	ATCGAT	1 cut(s)	1216
BseDI	CCNNGG	2 cut(s)	347, 636
BseGI	GGATG	5 cut(s)	118, 274, 676, 706, 1170
BseLI	CCNNNNNNNGG	6 cut(s)	294, 517, 949, 967, 1057, 1075
BseMI	GCAATG	1 cut(s)	154
BseMII	CTCAG	4 cut(s)	183, 234, 255, 549
BseNI	ACTGG	4 cut(s)	299, 336, 816, 892
BseRI	GAGGAG	1 cut(s)	209
BseSI	GKGCMC	2 cut(s)	934, 1042
BseXI	GCAGC	1 cut(s)	67
Bsh1236I	CGCG	2 cut(s)	982, 1090
BshFI	GGCC	8 cut(s)	509, 705, 800, 895, 932, 1003, 1040, 1183
BshVI	ATCGAT	1 cut(s)	1216
BsiHKAI	GWGCWC	3 cut(s)	35, 957, 1065
BsiSI	CCGG	2 cut(s)	179, 288
BslI	CCNNNNNNNGG	6 cut(s)	294, 517, 949, 967, 1057, 1075
BsmAI	GTCTC	2 cut(s)	191, 766
BsnI	GGCC	8 cut(s)	509, 705, 800, 895, 932, 1003, 1040, 1183
Bsp120I	GGGCCC	2 cut(s)	930, 1038
Bsp1286I	GDGCHC	5 cut(s)	35, 934, 957, 1042, 1065
Bsp13I	TCCGGA	1 cut(s)	287
Bsp143I	GATC	2 cut(s)	575, 1213
Bsp1720I	GCTNAGC	3 cut(s)	241, 976, 1084
BspACI	CCGC	5 cut(s)	116, 444, 801, 982, 1090
BspANI	GGCC	8 cut(s)	509, 705, 800, 895, 932, 1003, 1040, 1183
BspCNI	CTCAG	4 cut(s)	184, 233, 254, 548
BspDI	ATCGAT	1 cut(s)	1216
BspEI	TCCGGA	1 cut(s)	287
BspFNI	CGCG	2 cut(s)	982, 1090
BspHI	TCATGA	1 cut(s)	369
BspLI	GGNNCC	4 cut(s)	931, 932, 1039, 1040
BspOI	GCTAGC	3 cut(s)	807, 975, 1083
BspPI	GGATC	1 cut(s)	1221
BsrDI	GCAATG	1 cut(s)	154
BsrI	ACTGG	4 cut(s)	299, 336, 816, 892
BssECI	CCNNGG	2 cut(s)	347, 636
BssMI	GATC	2 cut(s)	575, 1213
BssNAI	GTATAC	1 cut(s)	410
BssNI	GRCGYC	1 cut(s)	432
Bst1107I	GTATAC	1 cut(s)	410
Bst2UI	CCWGG	2 cut(s)	348, 468
Bst4CI	ACNGT	5 cut(s)	41, 380, 481, 619, 659
BstACI	GRCGYC	1 cut(s)	432
BstC8I	GCNNGC	5 cut(s)	274, 805, 973, 1081, 1185
BstF5I	GGATG	5 cut(s)	118, 274, 676, 706, 1170
BstFNI	CGCG	2 cut(s)	982, 1090
BstHHI	GCGC	4 cut(s)	20, 809, 982, 1090
BstKTI	GATC	2 cut(s)	578, 1216
BstMAI	GTCTC	2 cut(s)	191, 766
BstMBI	GATC	2 cut(s)	575, 1213
BstNI	CCWGG	2 cut(s)	348, 468
BstSCI	CCNGG	2 cut(s)	346, 466
BstSFI	CTRYAG	1 cut(s)	477
BstSLI	GKGCMC	2 cut(s)	934, 1042
BstUI	CGCG	2 cut(s)	982, 1090
BstV1I	GCAGC	1 cut(s)	67
BstV2I	GAAGAC	2 cut(s)	43, 435
BstZ17I	GTATAC	1 cut(s)	410
Bsu15I	ATCGAT	1 cut(s)	1216
Bsu36I	CCTNAGG	1 cut(s)	192
BsuRI	GGCC	8 cut(s)	509, 705, 800, 895, 932, 1003, 1040, 1183
BsuTUI	ATCGAT	1 cut(s)	1216
BtsCI	GGATG	5 cut(s)	118, 274, 676, 706, 1170
BtsI	GCAGTG	2 cut(s)	252, 690
BtsIMutI	CAGTG	5 cut(s)	252, 329, 690, 809, 1199
Cac8I	GCNNGC	5 cut(s)	274, 805, 973, 1081, 1185
CciI	TCATGA	1 cut(s)	369
CfoI	GCGC	4 cut(s)	20, 809, 982, 1090
Cfr13I	GGNCC	5 cut(s)	508, 930, 931, 1038, 1039
ClaI	ATCGAT	1 cut(s)	1216
CseI	GACGC	1 cut(s)	34
CviAII	CATG	5 cut(s)	362, 370, 515, 593, 1269
DpnI	GATC	2 cut(s)	577, 1215
DpnII	GATC	2 cut(s)	575, 1213
DrdI	GACNNNNNNGTC	1 cut(s)	44
DseDI	GACNNNNNNGTC	1 cut(s)	44
EaeI	YGGCCR	1 cut(s)	798
Eco147I	AGGCCT	1 cut(s)	1183
Eco24I	GRGCYC	2 cut(s)	934, 1042
Eco32I	GATATC	1 cut(s)	1206
Eco57I	CTGAAG	1 cut(s)	761
Eco81I	CCTNAGG	1 cut(s)	192
EcoO109I	RGGNCCY	5 cut(s)	508, 930, 931, 1038, 1039
EcoRII	CCWGG	2 cut(s)	346, 466
EcoRV	GATATC	1 cut(s)	1206
EcoT22I	ATGCAT	1 cut(s)	1270
EcoT38I	GRGCYC	2 cut(s)	934, 1042
FaeI	CATG	5 cut(s)	365, 373, 518, 596, 1272
FalI	AAGNNNNNCTT	2 cut(s)	420, 452
FatI	CATG	5 cut(s)	361, 369, 514, 592, 1268
FblI	GTMKAC	1 cut(s)	409
Fnu4HI	GCNGC	4 cut(s)	81, 801, 983, 1091
FokI	GGATG	5 cut(s)	125, 281, 683, 713, 1177
FriOI	GRGCYC	2 cut(s)	934, 1042
Fsp4HI	GCNGC	4 cut(s)	81, 801, 983, 1091
FspBI	CTAG	5 cut(s)	299, 804, 834, 972, 1080
GlaI	GCGC	4 cut(s)	19, 808, 981, 1089
GluI	GCNGC	4 cut(s)	81, 801, 983, 1091
GsuI	CTGGAG	2 cut(s)	128, 833
HaeIII	GGCC	8 cut(s)	509, 705, 800, 895, 932, 1003, 1040, 1183
HapII	CCGG	2 cut(s)	179, 288
HgaI	GACGC	1 cut(s)	34
HhaI	GCGC	4 cut(s)	20, 809, 982, 1090
Hin1I	GRCGYC	1 cut(s)	432
Hin1II	CATG	5 cut(s)	365, 373, 518, 596, 1272
Hin6I	GCGC	4 cut(s)	18, 807, 980, 1088
HinP1I	GCGC	4 cut(s)	18, 807, 980, 1088
HincII	GTYRAC	1 cut(s)	631
HindII	GTYRAC	1 cut(s)	631
HinfI	GANTC	2 cut(s)	158, 589
HpaII	CCGG	2 cut(s)	179, 288
HphI	GGTGA	2 cut(s)	180, 1127
Hpy166II	GTNNAC	3 cut(s)	188, 410, 631
Hpy188I	TCNGA	7 cut(s)	37, 56, 163, 397, 554, 623, 640
Hpy188III	TCNNGA	6 cut(s)	107, 288, 370, 537, 779, 834
Hpy8I	GTNNAC	3 cut(s)	188, 410, 631
Hpy99I	CGWCG	3 cut(s)	41, 50, 68
HpyAV	CCTTC	6 cut(s)	70, 122, 214, 329, 993, 1105
HpyCH4III	ACNGT	5 cut(s)	41, 380, 481, 619, 659
HpyCH4IV	ACGT	2 cut(s)	432, 1256
HpyCH4V	TGCA	5 cut(s)	695, 851, 857, 1187, 1268
HpySE526I	ACGT	2 cut(s)	432, 1256
Hsp92I	GRCGYC	1 cut(s)	432
Hsp92II	CATG	5 cut(s)	365, 373, 518, 596, 1272
HspAI	GCGC	4 cut(s)	18, 807, 980, 1088
Kpn2I	TCCGGA	1 cut(s)	287
Kzo9I	GATC	2 cut(s)	575, 1213
LmnI	GCTCC	3 cut(s)	38, 952, 1060
Lsp1109I	GCAGC	1 cut(s)	67
LweI	GCATC	9 cut(s)	103, 160, 259, 844, 875, 994, 1102, 1155, 1255
MaeI	CTAG	5 cut(s)	299, 804, 834, 972, 1080
MaeII	ACGT	2 cut(s)	432, 1256
MaeIII	GTNAC	5 cut(s)	22, 327, 530, 688, 745
MalI	GATC	2 cut(s)	577, 1215
MboI	GATC	2 cut(s)	575, 1213
MboII	GAAGA	5 cut(s)	43, 167, 385, 440, 849
MfeI	CAATTG	2 cut(s)	741, 1188
MhlI	GDGCHC	5 cut(s)	35, 934, 957, 1042, 1065
MluCI	AATT	8 cut(s)	601, 741, 944, 1052, 1073, 1188, 1193, 1232
MmeI	TCCRAC	1 cut(s)	60
Mph1103I	ATGCAT	1 cut(s)	1270
MroI	TCCGGA	1 cut(s)	287
MroXI	GAANNNNTTC	1 cut(s)	387
MseI	TTAA	4 cut(s)	96, 342, 570, 1247
MspI	CCGG	2 cut(s)	179, 288
MspR9I	CCNGG	2 cut(s)	348, 468
MunI	CAATTG	2 cut(s)	741, 1188
MvaI	CCWGG	2 cut(s)	348, 468
MvnI	CGCG	2 cut(s)	982, 1090
NdeII	GATC	2 cut(s)	575, 1213
NheI	GCTAGC	3 cut(s)	803, 971, 1079
NlaIII	CATG	5 cut(s)	365, 373, 518, 596, 1272
NlaIV	GGNNCC	4 cut(s)	931, 932, 1039, 1040
NmuCI	GTSAC	3 cut(s)	22, 327, 688
NsiI	ATGCAT	1 cut(s)	1270
PagI	TCATGA	1 cut(s)	369
PceI	AGGCCT	1 cut(s)	1183
PcsI	WCGNNNNNNNCGW	1 cut(s)	45
PdmI	GAANNNNTTC	1 cut(s)	387
PfeI	GAWTC	2 cut(s)	158, 589
PkrI	GCNGC	4 cut(s)	82, 802, 984, 1092
PshBI	ATTAAT	2 cut(s)	96, 342
Psp1406I	AACGTT	1 cut(s)	1256
Psp6I	CCWGG	2 cut(s)	346, 466
PspGI	CCWGG	2 cut(s)	346, 466
PspN4I	GGNNCC	4 cut(s)	931, 932, 1039, 1040
PspOMI	GGGCCC	2 cut(s)	930, 1038
PspPI	GGNCC	5 cut(s)	508, 930, 931, 1038, 1039
SaqAI	TTAA	4 cut(s)	96, 342, 570, 1247
SatI	GCNGC	4 cut(s)	81, 801, 983, 1091
Sau3AI	GATC	2 cut(s)	575, 1213
Sau96I	GGNCC	5 cut(s)	508, 930, 931, 1038, 1039
ScrFI	CCNGG	2 cut(s)	348, 468
SduI	GDGCHC	5 cut(s)	35, 934, 957, 1042, 1065
SfaNI	GCATC	9 cut(s)	103, 160, 259, 844, 875, 994, 1102, 1155, 1255
SfcI	CTRYAG	1 cut(s)	477
Sse9I	AATT	8 cut(s)	601, 741, 944, 1052, 1073, 1188, 1193, 1232
SseBI	AGGCCT	1 cut(s)	1183
SsiI	CCGC	5 cut(s)	116, 444, 801, 982, 1090
SspMI	CTAG	5 cut(s)	299, 804, 834, 972, 1080
StuI	AGGCCT	1 cut(s)	1183
StyD4I	CCNGG	2 cut(s)	346, 466
TaaI	ACNGT	5 cut(s)	41, 380, 481, 619, 659
TaiI	ACGT	2 cut(s)	435, 1259
TaqI	TCGA	3 cut(s)	1216, 1223, 1237
TasI	AATT	8 cut(s)	601, 741, 944, 1052, 1073, 1188, 1193, 1232
TauI	GCSGC	3 cut(s)	803, 985, 1093
TfiI	GAWTC	2 cut(s)	158, 589
Tru1I	TTAA	4 cut(s)	96, 342, 570, 1247
Tru9I	TTAA	4 cut(s)	96, 342, 570, 1247
TscAI	CASTG	5 cut(s)	252, 336, 697, 816, 1206
TseFI	GTSAC	3 cut(s)	22, 327, 688
TseI	GCWGC	1 cut(s)	80
Tsp45I	GTSAC	3 cut(s)	22, 327, 688
TspDTI	ATGAA	5 cut(s)	243, 378, 386, 462, 581
TspGWI	ACGGA	2 cut(s)	713, 1011
TspRI	CASTG	5 cut(s)	252, 336, 697, 816, 1206
VspI	ATTAAT	2 cut(s)	96, 342
XapI	RAATTY	1 cut(s)	1232
XbaI	TCTAGA	1 cut(s)	833
XmiI	GTMKAC	1 cut(s)	409
XmnI	GAANNNNTTC	1 cut(s)	387
XspI	CTAG	5 cut(s)	299, 804, 834, 972, 1080
ZraI	GACGTC	1 cut(s)	433
Zsp2I	ATGCAT	1 cut(s)	1270

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.