Rmu_sc0002286.1_g000001

U1-like zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002286.1
OG0016854
Physical Location & Seq
Forward (+)
1 .. 5276
5276 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1098 bp
gttggccaacctccatataggggtatcggtgaagtgggtggtgaactattcagaggacatcaaggaaattttggctacagcggagctcacccatctttcattgggggatcacatggtcgaggtaggggtggttcttggcttttagtggaacatggtgtcccttcaacatcttctcatcctccccatcagacataccaatctccggtaacgctgacacctcagaagtcggaatctgcatcagcactgaaaacggaagttccaaactaccaaaaacctcaagttgctcaaaaaaccacggttacttggtgtgaagtttgtaatgcttcatgcgctaatttggacgttcttaaacagcaccaaaatggaaagcgacatcaaaggaacctgagaaaaatggaaaggttgaaaaacggtatcagaacagtggccaaattgcagggccaacagctttgcacttctaatacaaagcttgaagtgcctcatcagactcagtgtgaacaagacgatgaagagaaaaacacaacaaaggatataccatacgaacctgttggctatgaaaattcaagggaaactggaaaacaaaataagaaccccggacagcctgaaattccaccaggcgatgggtctgacaatgtgaagcgtggtaagaagcgcaagaaaacgaaaacgccgaagcagtcagtcaaaccttccaaacgtaaagtcgtaattccgatatttttgggtggtgatctgtttaagatttgtggtgacataccggtgctgaggtacgatcttacagatccggcaggagaggatgtagatggttggatcacgagggaagatgatggctacgggggtttggatcagcacaactttcttctttttttttatcagcacggtggtttgggtcttctctgtggtggcgatgtcgtcttgcgcagtaggtggcttttaaccggtgagtctgattctgttgctgtcggcagccttagtctgtctaggtccatcggtggagcagatagcagaggtttctcttctttggagctgcgacatcggtgggctggaaagctgctttcgagtcggcggtggacatggtggatgagccacatgcactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-C2H2_jaz zf-met

Protein Analysis

365

Amino Acids

40.4

Weight (kDa)

9.33

Isoelectric Point (pI)

48.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-met PF12874 102 - 125 4.2e-07 Zinc-finger of C2H2 type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016854)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g18930
prunus_persica Prupe.5G069800_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0203321
rosa_laevigata RLG00000003535
rosa_multiflora Rmu_sc0002286.1_g000001 Rmu_sc0003582.1_g000006
rosa_roxburghii Rroxscaffold_3G00253880
rosa_rugosa Rorug07G0075500 Rorug07G0075600
rosa_samantha Rh7AG205200 Rh7BG204600 Rh7CG216400 Rh7DG211700
rosa_wichuraiana Rw7G017870

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 920
AccB7I CCANNNNNTGG 1 cut(s) 620
AciI CCGC 2 cut(s) 81, 1066
AclWI GGATC 4 cut(s) 115, 776, 818, 852
AcoI YGGCCR 2 cut(s) 4, 426
AcsI RAATTY 3 cut(s) 67, 559, 606
AfaI GTAC 1 cut(s) 770
AfiI CCNNNNNNNGG 3 cut(s) 20, 202, 620
AgeI ACCGGT 2 cut(s) 757, 938
AgsI TTSAA 4 cut(s) 165, 406, 473, 564
AjnI CCWGG 1 cut(s) 613
AloI GAACNNNNNNTCC 2 cut(s) 141, 173
AluBI AGCT 5 cut(s) 86, 448, 469, 1027, 1051
AluI AGCT 5 cut(s) 86, 448, 469, 1027, 1051
Alw21I GWGCWC 1 cut(s) 88
AlwI GGATC 4 cut(s) 115, 776, 818, 852
AoxI GGCC 3 cut(s) 4, 426, 439
ApeKI GCWGC 3 cut(s) 966, 1027, 1051
ApoI RAATTY 3 cut(s) 67, 559, 606
ArsI GACNNNNNNTTYG 2 cut(s) 687, 719
AsiGI ACCGGT 2 cut(s) 757, 938
AspLEI GCGC 3 cut(s) 332, 654, 921
AspS9I GGNCC 2 cut(s) 439, 984
AsuC2I CCSGG 1 cut(s) 594
AsuHPI GGTGA 6 cut(s) 41, 53, 80, 740, 761, 953
AvaII GGWCC 1 cut(s) 984
BalI TGGCCA 2 cut(s) 6, 428
BanII GRGCYC 1 cut(s) 88
BauI CACGAG 1 cut(s) 814
BbsI GAAGAC 1 cut(s) 884
Bbv12I GWGCWC 1 cut(s) 88
BbvCI CCTCAGC 1 cut(s) 764
BbvI GCAGC 3 cut(s) 978, 1014, 1038
BccI CCATC 6 cut(s) 100, 192, 614, 797, 821, 995
BciT130I CCWGG 1 cut(s) 615
BcnI CCSGG 1 cut(s) 594
BfaI CTAG 1 cut(s) 981
BfmI CTRYAG 1 cut(s) 76
BisI GCNGC 3 cut(s) 967, 1028, 1052
BlsI GCNGC 3 cut(s) 968, 1029, 1053
Bme1390I CCNGG 2 cut(s) 594, 615
Bme18I GGWCC 1 cut(s) 984
BmgT120I GGNCC 2 cut(s) 439, 984
BmiI GGNNCC 1 cut(s) 383
BmrFI CCNGG 2 cut(s) 594, 615
BmsI GCATC 1 cut(s) 245
BpiI GAAGAC 1 cut(s) 884
Bpu10I CCTNAGC 1 cut(s) 764
BpuEI CTTGAG 1 cut(s) 261
BpuMI CCSGG 1 cut(s) 594
BsaJI CCNNGG 2 cut(s) 294, 592
BsaWI WCCGGW 3 cut(s) 202, 757, 938
BsaXI ACNNNNNCTCC 2 cut(s) 783, 813
Bsc4I CCNNNNNNNGG 3 cut(s) 20, 202, 620
Bse118I RCCGGY 2 cut(s) 757, 938
Bse1I ACTGG 1 cut(s) 577
BseBI CCWGG 1 cut(s) 615
BseDI CCNNGG 2 cut(s) 294, 592
BseGI GGATG 3 cut(s) 175, 802, 1086
BseLI CCNNNNNNNGG 3 cut(s) 20, 202, 620
BseMII CTCAG 4 cut(s) 233, 377, 503, 755
BseNI ACTGG 1 cut(s) 577
BseXI GCAGC 3 cut(s) 978, 1014, 1038
BshFI GGCC 3 cut(s) 6, 428, 441
BshTI ACCGGT 2 cut(s) 757, 938
BsiHKAI GWGCWC 1 cut(s) 88
BsiSI CCGG 5 cut(s) 203, 594, 758, 785, 939
BslFI GGGAC 1 cut(s) 143
BslI CCNNNNNNNGG 3 cut(s) 20, 202, 620
BsmFI GGGAC 1 cut(s) 143
BsnI GGCC 3 cut(s) 6, 428, 441
Bsp1286I GDGCHC 1 cut(s) 88
Bsp143I GATC 6 cut(s) 107, 730, 772, 781, 810, 844
BspACI CCGC 2 cut(s) 81, 1066
BspANI GGCC 3 cut(s) 6, 428, 441
BspCNI CTCAG 4 cut(s) 232, 378, 502, 756
BspLI GGNNCC 1 cut(s) 383
BspPI GGATC 4 cut(s) 115, 776, 818, 852
BsrFI RCCGGY 2 cut(s) 757, 938
BsrI ACTGG 1 cut(s) 577
BssAI RCCGGY 2 cut(s) 757, 938
BssECI CCNNGG 2 cut(s) 294, 592
BssMI GATC 6 cut(s) 107, 730, 772, 781, 810, 844
BssSI CACGAG 1 cut(s) 814
Bst2BI CACGAG 1 cut(s) 814
Bst2UI CCWGG 1 cut(s) 615
Bst4CI ACNGT 4 cut(s) 298, 413, 424, 881
Bst6I CTCTTC 2 cut(s) 504, 1021
BstDEI CTNAG 5 cut(s) 219, 386, 489, 764, 971
BstDSI CCRYGG 1 cut(s) 294
BstF5I GGATG 3 cut(s) 175, 802, 1086
BstHHI GCGC 3 cut(s) 332, 654, 921
BstKTI GATC 6 cut(s) 110, 733, 775, 784, 813, 847
BstMBI GATC 6 cut(s) 107, 730, 772, 781, 810, 844
BstMWI GCNNNNNNNGC 2 cut(s) 329, 475
BstNI CCWGG 1 cut(s) 615
BstNSI RCATGY 1 cut(s) 1093
BstSCI CCNGG 2 cut(s) 592, 613
BstSFI CTRYAG 1 cut(s) 76
BstV1I GCAGC 3 cut(s) 978, 1014, 1038
BstV2I GAAGAC 1 cut(s) 884
BstX2I RGATCY 1 cut(s) 781
BstYI RGATCY 1 cut(s) 781
BsuRI GGCC 3 cut(s) 6, 428, 441
BtgI CCRYGG 1 cut(s) 294
BtgZI GCGATG 2 cut(s) 633, 921
BtsCI GGATG 3 cut(s) 175, 802, 1086
BtsIMutI CAGTG 4 cut(s) 242, 429, 497, 1093
CfoI GCGC 3 cut(s) 332, 654, 921
Cfr10I RCCGGY 2 cut(s) 757, 938
Cfr13I GGNCC 2 cut(s) 439, 984
Csp6I GTAC 1 cut(s) 769
CspAI ACCGGT 2 cut(s) 757, 938
CviAII CATG 5 cut(s) 113, 152, 327, 1074, 1090
CviQI GTAC 1 cut(s) 769
DdeI CTNAG 5 cut(s) 219, 386, 489, 764, 971
DpnI GATC 6 cut(s) 109, 732, 774, 783, 812, 846
DpnII GATC 6 cut(s) 107, 730, 772, 781, 810, 844
EaeI YGGCCR 2 cut(s) 4, 426
Eam1104I CTCTTC 2 cut(s) 504, 1021
EarI CTCTTC 2 cut(s) 504, 1021
Ecl136II GAGCTC 1 cut(s) 86
Eco24I GRGCYC 1 cut(s) 88
Eco47I GGWCC 1 cut(s) 984
Eco53kI GAGCTC 1 cut(s) 86
EcoICRI GAGCTC 1 cut(s) 86
EcoRII CCWGG 1 cut(s) 613
EcoT38I GRGCYC 1 cut(s) 88
FaeI CATG 5 cut(s) 116, 155, 330, 1077, 1093
FaqI GGGAC 1 cut(s) 143
FatI CATG 5 cut(s) 112, 151, 326, 1073, 1089
Fnu4HI GCNGC 3 cut(s) 967, 1028, 1052
FokI GGATG 3 cut(s) 162, 809, 1093
FriOI GRGCYC 1 cut(s) 88
Fsp4HI GCNGC 3 cut(s) 967, 1028, 1052
FspBI CTAG 1 cut(s) 981
FspI TGCGCA 1 cut(s) 920
GlaI GCGC 3 cut(s) 331, 653, 920
GluI GCNGC 3 cut(s) 967, 1028, 1052
HaeIII GGCC 3 cut(s) 6, 428, 441
HapII CCGG 5 cut(s) 203, 594, 758, 785, 939
HhaI GCGC 3 cut(s) 332, 654, 921
Hin1II CATG 5 cut(s) 116, 155, 330, 1077, 1093
Hin6I GCGC 3 cut(s) 330, 652, 919
HinP1I GCGC 3 cut(s) 330, 652, 919
HindIII AAGCTT 1 cut(s) 467
HinfI GANTC 5 cut(s) 230, 487, 944, 950, 1060
HpaII CCGG 5 cut(s) 203, 594, 758, 785, 939
HphI GGTGA 6 cut(s) 41, 53, 80, 740, 761, 953
Hpy166II GTNNAC 3 cut(s) 44, 497, 1071
Hpy188I TCNGA 9 cut(s) 53, 189, 222, 229, 419, 486, 628, 714, 949
Hpy188III TCNNGA 1 cut(s) 814
Hpy8I GTNNAC 3 cut(s) 44, 497, 1071
HpyAV CCTTC 2 cut(s) 171, 699
HpyCH4III ACNGT 4 cut(s) 298, 413, 424, 881
HpyCH4IV ACGT 2 cut(s) 342, 697
HpyCH4V TGCA 4 cut(s) 236, 436, 453, 1093
HpyF10VI GCNNNNNNNGC 2 cut(s) 329, 475
HpyF3I CTNAG 5 cut(s) 219, 386, 489, 764, 971
HpySE526I ACGT 2 cut(s) 342, 697
Hsp92II CATG 5 cut(s) 116, 155, 330, 1077, 1093
HspAI GCGC 3 cut(s) 330, 652, 919
Kzo9I GATC 6 cut(s) 107, 730, 772, 781, 810, 844
LmnI GCTCC 3 cut(s) 83, 995, 1024
Lsp1109I GCAGC 3 cut(s) 978, 1014, 1038
LweI GCATC 1 cut(s) 245
MaeI CTAG 1 cut(s) 981
MaeII ACGT 2 cut(s) 342, 697
MaeIII GTNAC 3 cut(s) 205, 298, 749
MalI GATC 6 cut(s) 109, 732, 774, 783, 812, 846
MboI GATC 6 cut(s) 107, 730, 772, 781, 810, 844
MboII GAAGA 6 cut(s) 162, 521, 833, 851, 884, 1008
MflI RGATCY 1 cut(s) 781
MhlI GDGCHC 1 cut(s) 88
MlsI TGGCCA 2 cut(s) 6, 428
MluCI AATT 6 cut(s) 67, 334, 431, 559, 606, 708
MluNI TGGCCA 2 cut(s) 6, 428
MlyI GAGTC 3 cut(s) 481, 953, 1069
MmeI TCCRAC 2 cut(s) 207, 788
Mox20I TGGCCA 2 cut(s) 6, 428
MscI TGGCCA 2 cut(s) 6, 428
MseI TTAA 3 cut(s) 348, 738, 935
MslI CAYNNNNRTG 2 cut(s) 360, 758
Msp20I TGGCCA 2 cut(s) 6, 428
MspA1I CMGCKG 1 cut(s) 81
MspI CCGG 5 cut(s) 203, 594, 758, 785, 939
MspR9I CCNGG 2 cut(s) 594, 615
MvaI CCWGG 1 cut(s) 615
MwoI GCNNNNNNNGC 2 cut(s) 329, 475
NciI CCSGG 1 cut(s) 594
NdeII GATC 6 cut(s) 107, 730, 772, 781, 810, 844
NlaIII CATG 5 cut(s) 116, 155, 330, 1077, 1093
NlaIV GGNNCC 1 cut(s) 383
NmuCI GTSAC 1 cut(s) 749
NsbI TGCGCA 1 cut(s) 920
NspI RCATGY 1 cut(s) 1093
PcsI WCGNNNNNNNCGW 1 cut(s) 668
PfeI GAWTC 2 cut(s) 230, 950
PflMI CCANNNNNTGG 1 cut(s) 620
PinAI ACCGGT 2 cut(s) 757, 938
PkrI GCNGC 3 cut(s) 968, 1029, 1053
PleI GAGTC 3 cut(s) 481, 952, 1068
PpsI GAGTC 3 cut(s) 481, 952, 1068
Psp124BI GAGCTC 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 613
PspGI CCWGG 1 cut(s) 613
PspN4I GGNNCC 1 cut(s) 383
PspPI GGNCC 2 cut(s) 439, 984
PsrI GAACNNNNNNTAC 2 cut(s) 115, 147
PsuI RGATCY 1 cut(s) 781
RsaI GTAC 1 cut(s) 770
RsaNI GTAC 1 cut(s) 769
RseI CAYNNNNRTG 2 cut(s) 360, 758
SacI GAGCTC 1 cut(s) 88
SaqAI TTAA 3 cut(s) 348, 738, 935
SatI GCNGC 3 cut(s) 967, 1028, 1052
Sau3AI GATC 6 cut(s) 107, 730, 772, 781, 810, 844
Sau96I GGNCC 2 cut(s) 439, 984
SchI GAGTC 3 cut(s) 481, 953, 1069
ScrFI CCNGG 2 cut(s) 594, 615
SduI GDGCHC 1 cut(s) 88
SfaNI GCATC 1 cut(s) 245
SfcI CTRYAG 1 cut(s) 76
SinI GGWCC 1 cut(s) 984
SmiMI CAYNNNNRTG 2 cut(s) 360, 758
SmlI CTYRAG 1 cut(s) 276
SmoI CTYRAG 1 cut(s) 276
Sse9I AATT 6 cut(s) 67, 334, 431, 559, 606, 708
SsiI CCGC 2 cut(s) 81, 1066
SspMI CTAG 1 cut(s) 981
SstI GAGCTC 1 cut(s) 88
StyD4I CCNGG 2 cut(s) 592, 613
TaaI ACNGT 4 cut(s) 298, 413, 424, 881
TaiI ACGT 2 cut(s) 345, 700
TaqI TCGA 2 cut(s) 118, 1058
TasI AATT 6 cut(s) 67, 334, 431, 559, 606, 708
TfiI GAWTC 2 cut(s) 230, 950
Tru1I TTAA 3 cut(s) 348, 738, 935
Tru9I TTAA 3 cut(s) 348, 738, 935
TscAI CASTG 3 cut(s) 249, 429, 497
TseFI GTSAC 1 cut(s) 749
TseI GCWGC 3 cut(s) 966, 1027, 1051
Tsp45I GTSAC 1 cut(s) 749
TspDTI ATGAA 4 cut(s) 88, 315, 522, 570
TspGWI ACGGA 1 cut(s) 266
TspRI CASTG 3 cut(s) 249, 429, 497
Van91I CCANNNNNTGG 1 cut(s) 620
VpaK11BI GGWCC 1 cut(s) 984
XapI RAATTY 3 cut(s) 67, 559, 606
XceI RCATGY 1 cut(s) 1093
XspI CTAG 1 cut(s) 981
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.