Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002532.1

Orthogroup ID

OG0016984

Physical Location & Seq

Genomic Coordinates Reverse (-)

141838 .. 143608

Gene Structure 1771 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002532.1_g000028.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 513 bp

atgttgagattggtagctccacccgttgcaaccacatcattagtgacgttaatattcagttgtgaattagtagtagcagcacatataggctatgtttggtacggctgggcttttcagaaaagctggcttctgcttatttctgagaataagtggctgaaaagcaaagtagctgagtgtttgatcgacgtcggggctgcggtctctggtgacggacggagatggggagacggggagcagcgacgatgtgagggagagcgatgcttgcgtgctaatacgtatgtgatggggagcagcgacgatgcggcggtgacggggagctgcgaggatgcggcggtgagggagcagcgagatggtaactaccggctacagtgtttccgtggcttctggcttatggaagctgcattcttcagcttctgcttatctaaggaagccacagcagcttctgaaaaaagctgccaagaagctgagttaccaaacaccaatttgaacttggcttataagcacaggagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

170

Amino Acids

18.95

Weight (kDa)

6.14

Isoelectric Point (pI)

45.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016984)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0164601
rosa_laevigata	RLG00000016816
rosa_multiflora	Rmu_sc0001557.1_g000008 Rmu_sc0002489.1_g000013 Rmu_sc0002532.1_g000028 Rmu_sc0003710.1_g000006
rosa_roxburghii	Rroxscaffold_2G00087760 Rroxscaffold_4G00327750 Rroxscaffold_7G00160260
rosa_samantha	Rh3AG292100 Rh3BG329400 Rh3CG326500 Rh3DG325400 Rh7AG458700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	498
AatII	GACGTC	1 cut(s)	189
AciI	CCGC	5 cut(s)	197, 302, 305, 329, 332
AcuI	CTGAAG	1 cut(s)	391
AcyI	GRCGYC	1 cut(s)	186
AfaI	GTAC	1 cut(s)	101
AgsI	TTSAA	1 cut(s)	487
Alw26I	GTCTC	2 cut(s)	205, 219
AlwNI	CAGNNNCTG	3 cut(s)	414, 443, 510
ApeKI	GCWGC	9 cut(s)	77, 194, 235, 291, 318, 343, 398, 437, 453
AsuHPI	GGTGA	3 cut(s)	218, 319, 346
BarI	GAAGNNNNNNTAC	2 cut(s)	453, 485
BbvI	GCAGC	9 cut(s)	89, 181, 247, 303, 305, 355, 385, 440, 449
BccI	CCATC	3 cut(s)	213, 277, 344
BceAI	ACGGC	1 cut(s)	118
BcoDI	GTCTC	2 cut(s)	205, 219
BfmI	CTRYAG	1 cut(s)	365
BmsI	GCATC	3 cut(s)	248, 289, 316
BsaAI	YACGTR	1 cut(s)	276
BsaHI	GRCGYC	1 cut(s)	186
BsaI	GGTCTC	1 cut(s)	205
BsaJI	CCNNGG	1 cut(s)	376
Bse118I	RCCGGY	1 cut(s)	360
BseDI	CCNNGG	1 cut(s)	376
BseGI	GGATG	1 cut(s)	331
BseMII	CTCAG	3 cut(s)	132, 162, 456
BseXI	GCAGC	9 cut(s)	89, 181, 247, 303, 305, 355, 385, 440, 449
BseYI	CCCAGC	1 cut(s)	105
BsiSI	CCGG	1 cut(s)	361
BsmAI	GTCTC	2 cut(s)	205, 219
BsmBI	CGTCTC	1 cut(s)	219
BsmI	GAATGC	1 cut(s)	401
Bso31I	GGTCTC	1 cut(s)	205
Bsp143I	GATC	1 cut(s)	180
BspACI	CCGC	5 cut(s)	197, 302, 305, 329, 332
BspCNI	CTCAG	3 cut(s)	133, 163, 457
BspTNI	GGTCTC	1 cut(s)	205
BsrFI	RCCGGY	1 cut(s)	360
BssAI	RCCGGY	1 cut(s)	360
BssECI	CCNNGG	1 cut(s)	376
BssMI	GATC	1 cut(s)	180
BssNI	GRCGYC	1 cut(s)	186
Bst4CI	ACNGT	1 cut(s)	369
BstACI	GRCGYC	1 cut(s)	186
BstBAI	YACGTR	1 cut(s)	276
BstC8I	GCNNGC	3 cut(s)	125, 263, 267
BstDEI	CTNAG	4 cut(s)	141, 171, 423, 465
BstDSI	CCRYGG	1 cut(s)	376
BstF5I	GGATG	1 cut(s)	331
BstKTI	GATC	1 cut(s)	183
BstMAI	GTCTC	2 cut(s)	205, 219
BstMBI	GATC	1 cut(s)	180
BstMWI	GCNNNNNNNGC	2 cut(s)	262, 437
BstSFI	CTRYAG	1 cut(s)	365
BstSNI	TACGTA	1 cut(s)	276
BstV1I	GCAGC	9 cut(s)	89, 181, 247, 303, 305, 355, 385, 440, 449
BtgI	CCRYGG	1 cut(s)	376
BtgZI	GCGATG	1 cut(s)	271
BtsCI	GGATG	1 cut(s)	331
BtsIMutI	CAGTG	1 cut(s)	374
Cac8I	GCNNGC	3 cut(s)	125, 263, 267
CaiI	CAGNNNCTG	3 cut(s)	414, 443, 510
Cfr10I	RCCGGY	1 cut(s)	360
Csp6I	GTAC	1 cut(s)	100
CviQI	GTAC	1 cut(s)	100
DdeI	CTNAG	4 cut(s)	141, 171, 423, 465
DpnI	GATC	1 cut(s)	182
DpnII	GATC	1 cut(s)	180
Eco105I	TACGTA	1 cut(s)	276
Eco31I	GGTCTC	1 cut(s)	205
Eco57I	CTGAAG	1 cut(s)	391
Esp3I	CGTCTC	1 cut(s)	219
FaiI	YATR	6 cut(s)	84, 86, 93, 279, 392, 498
FokI	GGATG	1 cut(s)	338
GsaI	CCCAGC	1 cut(s)	109
HapII	CCGG	1 cut(s)	361
Hin1I	GRCGYC	1 cut(s)	186
HpaII	CCGG	1 cut(s)	361
HphI	GGTGA	3 cut(s)	218, 319, 346
Hpy188I	TCNGA	3 cut(s)	117, 142, 445
Hpy99I	CGWCG	4 cut(s)	188, 191, 243, 299
HpyCH4III	ACNGT	1 cut(s)	369
HpyCH4IV	ACGT	3 cut(s)	47, 186, 275
HpyCH4V	TGCA	2 cut(s)	29, 401
HpyF10VI	GCNNNNNNNGC	2 cut(s)	262, 437
HpyF3I	CTNAG	4 cut(s)	141, 171, 423, 465
HpySE526I	ACGT	3 cut(s)	47, 186, 275
Hsp92I	GRCGYC	1 cut(s)	186
Kzo9I	GATC	1 cut(s)	180
LmnI	GCTCC	6 cut(s)	22, 232, 288, 315, 340, 507
LpnPI	CCDG	6 cut(s)	91, 109, 189, 370, 374, 490
Lsp1109I	GCAGC	9 cut(s)	89, 181, 247, 303, 305, 355, 385, 440, 449
LweI	GCATC	3 cut(s)	248, 289, 316
MaeII	ACGT	3 cut(s)	47, 186, 275
MaeIII	GTNAC	5 cut(s)	43, 206, 307, 353, 468
MalI	GATC	1 cut(s)	182
MboI	GATC	1 cut(s)	180
MboII	GAAGA	1 cut(s)	397
MluCI	AATT	2 cut(s)	65, 481
MnlI	CCTC	3 cut(s)	241, 316, 330
MseI	TTAA	1 cut(s)	50
MspI	CCGG	1 cut(s)	361
Mva1269I	GAATGC	1 cut(s)	401
MwoI	GCNNNNNNNGC	2 cut(s)	262, 437
NdeII	GATC	1 cut(s)	180
NmuCI	GTSAC	3 cut(s)	43, 206, 307
PctI	GAATGC	1 cut(s)	401
Ppu21I	YACGTR	1 cut(s)	276
PsiI	TTATAA	1 cut(s)	498
PspFI	CCCAGC	1 cut(s)	105
PstNI	CAGNNNCTG	3 cut(s)	414, 443, 510
RsaI	GTAC	1 cut(s)	101
RsaNI	GTAC	1 cut(s)	100
SaqAI	TTAA	1 cut(s)	50
Sau3AI	GATC	1 cut(s)	180
SfaNI	GCATC	3 cut(s)	248, 289, 316
SfcI	CTRYAG	1 cut(s)	365
SnaBI	TACGTA	1 cut(s)	276
Sse9I	AATT	2 cut(s)	65, 481
SsiI	CCGC	5 cut(s)	197, 302, 305, 329, 332
SspI	AATATT	1 cut(s)	54
TaaI	ACNGT	1 cut(s)	369
TaiI	ACGT	3 cut(s)	50, 189, 278
TaqI	TCGA	1 cut(s)	183
TasI	AATT	2 cut(s)	65, 481
TauI	GCSGC	2 cut(s)	305, 332
Tru1I	TTAA	1 cut(s)	50
Tru9I	TTAA	1 cut(s)	50
TscAI	CASTG	1 cut(s)	374
TseFI	GTSAC	3 cut(s)	43, 206, 307
TseI	GCWGC	9 cut(s)	77, 194, 235, 291, 318, 343, 398, 437, 453
Tsp45I	GTSAC	3 cut(s)	43, 206, 307
TspGWI	ACGGA	3 cut(s)	225, 229, 365
TspRI	CASTG	1 cut(s)	374
XcmI	CCANNNNNNNNNTGG	1 cut(s)	487
ZraI	GACGTC	1 cut(s)	187

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.