Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002624.1

Orthogroup ID

OG0005988

Physical Location & Seq

Genomic Coordinates Reverse (-)

24067 .. 27119

Gene Structure 3053 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002624.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1434 bp

atggcttctaaggaacatgtatgtgacaattacgtgtttttgaagccagaagaagtaactctcatcgaacttagtagctttctgttttcctctgatttagagaacagaagattcatcaattcctcggaagaggaagggaagaacggagggaatttagaacggaggtggataatcttcatctctgttgtactgcaatgggttttcctcttttgcagtgttcctatggcgagaataggggatgtgctccagaaatggctcaaccttgtctcgaccaacggcggaccactcatgctcttcttaaactggctaagaggaaaggtggtcaagccggattcattatcatcgacatcagtgttgggaaatcttgacaggagaattgaattagacaagagcatcaaacctgaggatacaagatacaaagcggctctctccatcatggctgctaagttgtcatacgagaacaaagacctcgttcaatccgtcgttaatcatcactggaagatgaaattcgtgggattttacaactttcggaatggttaccaagggcgagattcaacacaggcctttctgttcaaagacacattgtctgaccctaacttgattgtggtggcatttagaggcactgctccatttgatgcggatgcatggaggacagatttcgacatctcatggtgcgagttcaacaaagtcggtaagacgcacggcggcttcatgaaagctctcggcctacaaccaaacaatcgttggccacttgaactagaaactgagcacctacaaggcagtcaccaacatcctcagtttgcttactacacaatcagacaaatgctgaaagatttactgcaagaggatgagaatgccaagtttatattgacggggcacagcttgggcggggcgttggcgattttgtttgccggggtgctagcaatgcatgactgtgagtatgcctggttgctggagaggttggagggggtttacacgttcggacagcctagggttggagatgggaagtttggggtgtttatgaaggaaaagtttaggaaatatgatgtgagatatatgaggtatgtttacagcaatgatctggtgcctagaataccttatgatgataaagccctcttgttcaagcactttgggccaagtctttactacaacagctgctatggaggaaaggttttgaaggaggaacccaacaagaactactttagtttgctatggttcatacctaagaggatgactgcagtgtgggagctgttaaggagcttcatactccctttggtaaggggttcagactacaaagaggggtggtttatgagattttggaggctggtgggattagtaattccaggattggcagcccatgctcctcaagattacgtcaatcttacaagattgggaaccctgcttattcctaaagaaagtcctaaagtcgagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0005615 GO:0044421

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_3

Protein Analysis

477

Amino Acids

55.12

Weight (kDa)

8.8

Isoelectric Point (pI)

39.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005988)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G56630 AT5G42930 AT5G42930
fragaria_vesca	FvH4_2g34290
malus_domestica	MD15G1081200.v1.1 MD15G1081300.v1.1
prunus_persica	Prupe.1G434100_v2.0.a1 Prupe.1G434100_v2.0.a1 Prupe.1G434100_v2.0.a1
pyrus_communis	pycom15g07570 pycom15g07590 pycom15g07600
rosa_chinensis	RchiOBHm_Chr6g0308081
rosa_laevigata	RLG00000010669 RLG00000010670
rosa_multiflora	Rmu_sc0002624.1_g000005
rosa_roxburghii	Rroxscaffold_7G00160580 Rroxscaffold_7G00160590 Rroxscaffold_7G00160600
rosa_rugosa	Rorug06G0363600 Rorug06G0363900
rosa_samantha	Rh6AG472600 Rh6BG483700 Rh6CG488500 Rh6CG488600 Rh6DG475000
rosa_wichuraiana	Rw6G041240

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	1084
AciI	CCGC	5 cut(s)	279, 422, 638, 705, 888
AcoI	YGGCCR	1 cut(s)	746
AcsI	RAATTY	2 cut(s)	151, 506
AfaI	GTAC	1 cut(s)	189
AfiI	CCNNNNNNNGG	1 cut(s)	995
AflIII	ACRYGT	3 cut(s)	16, 33, 975
AgsI	TTSAA	9 cut(s)	43, 380, 476, 555, 574, 682, 755, 1123, 1177
AhdI	GACNNNNNGTC	1 cut(s)	583
AjnI	CCWGG	2 cut(s)	944, 1342
AluBI	AGCT	6 cut(s)	78, 719, 882, 1155, 1249, 1260
AluI	AGCT	6 cut(s)	78, 719, 882, 1155, 1249, 1260
Alw21I	GWGCWC	2 cut(s)	246, 771
Alw26I	GTCTC	1 cut(s)	271
AoxI	GGCC	4 cut(s)	561, 724, 746, 1133
ApeKI	GCWGC	3 cut(s)	440, 1155, 1352
ApoI	RAATTY	2 cut(s)	151, 506
AspA2I	CCTAGG	1 cut(s)	989
AspS9I	GGNCC	2 cut(s)	281, 1133
AsuC2I	CCSGG	1 cut(s)	913
AsuHPI	GGTGA	1 cut(s)	776
AsuNHI	GCTAGC	1 cut(s)	919
AvaII	GGWCC	1 cut(s)	281
AvrII	CCTAGG	1 cut(s)	989
AxyI	CCTNAGG	1 cut(s)	402
BaeGI	GKGCMC	1 cut(s)	879
BalI	TGGCCA	1 cut(s)	748
BanI	GGYRCC	1 cut(s)	1084
Bbv12I	GWGCWC	2 cut(s)	246, 771
BbvI	GCAGC	3 cut(s)	427, 1142, 1364
BccI	CCATC	2 cut(s)	440, 995
BceAI	ACGGC	2 cut(s)	292, 718
BciT130I	CCWGG	2 cut(s)	946, 1344
BciVI	GTATCC	1 cut(s)	400
BcnI	CCSGG	1 cut(s)	913
BcoDI	GTCTC	1 cut(s)	271
BfaI	CTAG	4 cut(s)	758, 920, 990, 1089
BfmI	CTRYAG	1 cut(s)	1236
BfuI	GTATCC	1 cut(s)	400
BisI	GCNGC	5 cut(s)	423, 441, 706, 1156, 1353
BlnI	CCTAGG	1 cut(s)	989
BlsI	GCNGC	5 cut(s)	424, 442, 707, 1157, 1354
Bme1390I	CCNGG	3 cut(s)	913, 946, 1344
Bme18I	GGWCC	1 cut(s)	281
BmeRI	GACNNNNNGTC	1 cut(s)	583
BmgT120I	GGNCC	2 cut(s)	281, 1133
BmiI	GGNNCC	3 cut(s)	1086, 1185, 1396
BmrFI	CCNGG	3 cut(s)	913, 946, 1344
BmsI	GCATC	3 cut(s)	402, 625, 631
BmtI	GCTAGC	1 cut(s)	923
BpmI	CTGGAG	2 cut(s)	230, 974
BpuEI	CTTGAG	1 cut(s)	1350
BpuMI	CCSGG	1 cut(s)	913
BsaAI	YACGTR	1 cut(s)	34
BsaJI	CCNNGG	4 cut(s)	123, 541, 912, 989
BsaXI	ACNNNNNCTCC	2 cut(s)	1155, 1185
Bsc4I	CCNNNNNNNGG	1 cut(s)	995
Bse1I	ACTGG	2 cut(s)	308, 500
Bse21I	CCTNAGG	1 cut(s)	402
Bse3DI	GCAATG	3 cut(s)	200, 930, 1081
BseBI	CCWGG	2 cut(s)	946, 1344
BseDI	CCNNGG	4 cut(s)	123, 541, 912, 989
BseGI	GGATG	5 cut(s)	244, 646, 790, 853, 1236
BseLI	CCNNNNNNNGG	1 cut(s)	995
BseMI	GCAATG	3 cut(s)	200, 930, 1081
BseMII	CTCAG	3 cut(s)	393, 756, 809
BseNI	ACTGG	2 cut(s)	308, 500
BseRI	GAGGAG	1 cut(s)	1353
BseSI	GKGCMC	1 cut(s)	879
BseXI	GCAGC	3 cut(s)	427, 1142, 1364
BshFI	GGCC	4 cut(s)	563, 726, 748, 1135
BshNI	GGYRCC	1 cut(s)	1084
BsiHKAI	GWGCWC	2 cut(s)	246, 771
BsiSI	CCGG	2 cut(s)	329, 912
BslI	CCNNNNNNNGG	1 cut(s)	995
BsmAI	GTCTC	1 cut(s)	271
BsmI	GAATGC	1 cut(s)	859
BsnI	GGCC	4 cut(s)	563, 726, 748, 1135
Bsp1286I	GDGCHC	3 cut(s)	246, 771, 879
Bsp143I	GATC	1 cut(s)	1078
BspACI	CCGC	5 cut(s)	279, 422, 638, 705, 888
BspANI	GGCC	4 cut(s)	563, 726, 748, 1135
BspCNI	CTCAG	3 cut(s)	394, 757, 808
BspHI	TCATGA	1 cut(s)	711
BspLI	GGNNCC	3 cut(s)	1086, 1185, 1396
BspMAI	CTGCAG	1 cut(s)	1240
BspOI	GCTAGC	1 cut(s)	923
BspQI	GCTCTTC	1 cut(s)	299
BspT107I	GGYRCC	1 cut(s)	1084
BsrDI	GCAATG	3 cut(s)	200, 930, 1081
BsrI	ACTGG	2 cut(s)	308, 500
BssECI	CCNNGG	4 cut(s)	123, 541, 912, 989
BssMI	GATC	1 cut(s)	1078
BssT1I	CCWWGG	2 cut(s)	541, 989
Bst2UI	CCWGG	2 cut(s)	946, 1344
Bst4CI	ACNGT	1 cut(s)	935
Bst6I	CTCTTC	2 cut(s)	123, 299
BstAPI	GCANNNNNTGC	1 cut(s)	1358
BstBAI	YACGTR	1 cut(s)	34
BstC8I	GCNNGC	1 cut(s)	921
BstDEI	CTNAG	8 cut(s)	9, 71, 308, 402, 444, 765, 795, 1224
BstEII	GGTNACC	1 cut(s)	536
BstF5I	GGATG	5 cut(s)	244, 646, 790, 853, 1236
BstKTI	GATC	1 cut(s)	1081
BstMAI	GTCTC	1 cut(s)	271
BstMBI	GATC	1 cut(s)	1078
BstMWI	GCNNNNNNNGC	3 cut(s)	925, 1132, 1358
BstNI	CCWGG	2 cut(s)	946, 1344
BstNSI	RCATGY	1 cut(s)	20
BstPI	GGTNACC	1 cut(s)	536
BstSCI	CCNGG	3 cut(s)	911, 944, 1342
BstSFI	CTRYAG	1 cut(s)	1236
BstSLI	GKGCMC	1 cut(s)	879
BstV1I	GCAGC	3 cut(s)	427, 1142, 1364
Bsu36I	CCTNAGG	1 cut(s)	402
BsuI	GTATCC	1 cut(s)	400
BsuRI	GGCC	4 cut(s)	563, 726, 748, 1135
BtsCI	GGATG	5 cut(s)	244, 646, 790, 853, 1236
BtsI	GCAGTG	3 cut(s)	220, 621, 1245
BtsIMutI	CAGTG	5 cut(s)	220, 357, 493, 621, 1245
Cac8I	GCNNGC	1 cut(s)	921
CciI	TCATGA	1 cut(s)	711
Cfr13I	GGNCC	2 cut(s)	281, 1133
CseI	GACGC	1 cut(s)	706
Csp6I	GTAC	1 cut(s)	188
CviAII	CATG	8 cut(s)	17, 289, 436, 645, 669, 712, 929, 1358
CviQI	GTAC	1 cut(s)	188
DdeI	CTNAG	8 cut(s)	9, 71, 308, 402, 444, 765, 795, 1224
DpnI	GATC	1 cut(s)	1080
DpnII	GATC	1 cut(s)	1078
DriI	GACNNNNNGTC	1 cut(s)	583
EaeI	YGGCCR	1 cut(s)	746
Eam1104I	CTCTTC	2 cut(s)	123, 299
Eam1105I	GACNNNNNGTC	1 cut(s)	583
EarI	CTCTTC	2 cut(s)	123, 299
EciI	GGCGGA	1 cut(s)	294
Eco130I	CCWWGG	2 cut(s)	541, 989
Eco147I	AGGCCT	1 cut(s)	563
Eco47I	GGWCC	1 cut(s)	281
Eco81I	CCTNAGG	1 cut(s)	402
Eco91I	GGTNACC	1 cut(s)	536
EcoO65I	GGTNACC	1 cut(s)	536
EcoRII	CCWGG	2 cut(s)	944, 1342
EcoT14I	CCWWGG	2 cut(s)	541, 989
EcoT22I	ATGCAT	2 cut(s)	646, 930
ErhI	CCWWGG	2 cut(s)	541, 989
FaeI	CATG	8 cut(s)	20, 292, 439, 648, 672, 715, 932, 1361
FalI	AAGNNNNNCTT	2 cut(s)	1184, 1216
FatI	CATG	8 cut(s)	16, 288, 435, 644, 668, 711, 928, 1357
FauI	CCCGC	1 cut(s)	881
Fnu4HI	GCNGC	5 cut(s)	423, 441, 706, 1156, 1353
FokI	GGATG	5 cut(s)	251, 653, 777, 860, 1243
Fsp4HI	GCNGC	5 cut(s)	423, 441, 706, 1156, 1353
FspBI	CTAG	4 cut(s)	758, 920, 990, 1089
GluI	GCNGC	5 cut(s)	423, 441, 706, 1156, 1353
GsuI	CTGGAG	2 cut(s)	230, 974
HaeIII	GGCC	4 cut(s)	563, 726, 748, 1135
HapII	CCGG	2 cut(s)	329, 912
HgaI	GACGC	1 cut(s)	706
Hin1II	CATG	8 cut(s)	20, 292, 439, 648, 672, 715, 932, 1361
HinfI	GANTC	3 cut(s)	111, 332, 551
HpaII	CCGG	2 cut(s)	329, 912
HphI	GGTGA	1 cut(s)	776
Hpy166II	GTNNAC	2 cut(s)	973, 1069
Hpy188I	TCNGA	7 cut(s)	94, 127, 531, 589, 818, 983, 1288
Hpy188III	TCNNGA	5 cut(s)	247, 268, 365, 712, 1367
Hpy8I	GTNNAC	2 cut(s)	973, 1069
Hpy99I	CGWCG	1 cut(s)	485
HpyAV	CCTTC	3 cut(s)	128, 1018, 1171
HpyCH4III	ACNGT	1 cut(s)	935
HpyCH4IV	ACGT	3 cut(s)	33, 977, 1374
HpyCH4V	TGCA	6 cut(s)	193, 213, 644, 841, 928, 1238
HpyF10VI	GCNNNNNNNGC	3 cut(s)	925, 1132, 1358
HpyF3I	CTNAG	8 cut(s)	9, 71, 308, 402, 444, 765, 795, 1224
HpySE526I	ACGT	3 cut(s)	33, 977, 1374
Hsp92II	CATG	8 cut(s)	20, 292, 439, 648, 672, 715, 932, 1361
Kzo9I	GATC	1 cut(s)	1078
LguI	GCTCTTC	1 cut(s)	299
LmnI	GCTCC	5 cut(s)	249, 631, 1246, 1257, 1366
Lsp1109I	GCAGC	3 cut(s)	427, 1142, 1364
LweI	GCATC	3 cut(s)	402, 625, 631
MaeI	CTAG	4 cut(s)	758, 920, 990, 1089
MaeII	ACGT	3 cut(s)	33, 977, 1374
MaeIII	GTNAC	4 cut(s)	23, 55, 536, 782
MalI	GATC	1 cut(s)	1080
MboI	GATC	1 cut(s)	1078
MboII	GAAGA	7 cut(s)	62, 120, 140, 151, 166, 286, 511
MhlI	GDGCHC	3 cut(s)	246, 771, 879
MlsI	TGGCCA	1 cut(s)	748
MluCI	AATT	7 cut(s)	28, 118, 151, 375, 380, 506, 1338
MluNI	TGGCCA	1 cut(s)	748
MmeI	TCCRAC	2 cut(s)	942, 976
Mox20I	TGGCCA	1 cut(s)	748
Mph1103I	ATGCAT	2 cut(s)	646, 930
MscI	TGGCCA	1 cut(s)	748
MseI	TTAA	3 cut(s)	299, 486, 1253
MslI	CAYNNNNRTG	2 cut(s)	21, 933
Msp20I	TGGCCA	1 cut(s)	748
MspA1I	CMGCKG	1 cut(s)	1155
MspI	CCGG	2 cut(s)	329, 912
MspR9I	CCNGG	3 cut(s)	913, 946, 1344
Mva1269I	GAATGC	1 cut(s)	859
MvaI	CCWGG	2 cut(s)	946, 1344
MwoI	GCNNNNNNNGC	3 cut(s)	925, 1132, 1358
NciI	CCSGG	1 cut(s)	913
NdeII	GATC	1 cut(s)	1078
NheI	GCTAGC	1 cut(s)	919
NlaIII	CATG	8 cut(s)	20, 292, 439, 648, 672, 715, 932, 1361
NlaIV	GGNNCC	3 cut(s)	1086, 1185, 1396
NmeAIII	GCCGAG	1 cut(s)	702
NmuCI	GTSAC	2 cut(s)	23, 782
NsiI	ATGCAT	2 cut(s)	646, 930
NspI	RCATGY	1 cut(s)	20
PagI	TCATGA	1 cut(s)	711
PceI	AGGCCT	1 cut(s)	563
PciI	ACATGT	1 cut(s)	16
PciSI	GCTCTTC	1 cut(s)	299
PcsI	WCGNNNNNNNCGW	1 cut(s)	477
PctI	GAATGC	1 cut(s)	859
PfeI	GAWTC	3 cut(s)	111, 332, 551
PfoI	TCCNGGA	1 cut(s)	1342
PkrI	GCNGC	5 cut(s)	424, 442, 707, 1157, 1354
Ppu21I	YACGTR	1 cut(s)	34
PscI	ACATGT	1 cut(s)	16
Psp6I	CCWGG	2 cut(s)	944, 1342
PspEI	GGTNACC	1 cut(s)	536
PspGI	CCWGG	2 cut(s)	944, 1342
PspN4I	GGNNCC	3 cut(s)	1086, 1185, 1396
PspPI	GGNCC	2 cut(s)	281, 1133
PstI	CTGCAG	1 cut(s)	1240
PvuII	CAGCTG	1 cut(s)	1155
RsaI	GTAC	1 cut(s)	189
RsaNI	GTAC	1 cut(s)	188
RseI	CAYNNNNRTG	2 cut(s)	21, 933
SapI	GCTCTTC	1 cut(s)	299
SaqAI	TTAA	3 cut(s)	299, 486, 1253
SatI	GCNGC	5 cut(s)	423, 441, 706, 1156, 1353
Sau3AI	GATC	1 cut(s)	1078
Sau96I	GGNCC	2 cut(s)	281, 1133
ScrFI	CCNGG	3 cut(s)	913, 946, 1344
SduI	GDGCHC	3 cut(s)	246, 771, 879
SfaNI	GCATC	3 cut(s)	402, 625, 631
SfcI	CTRYAG	1 cut(s)	1236
SinI	GGWCC	1 cut(s)	281
SmiMI	CAYNNNNRTG	2 cut(s)	21, 933
SmlI	CTYRAG	1 cut(s)	1365
SmoI	CTYRAG	1 cut(s)	1365
Sse9I	AATT	7 cut(s)	28, 118, 151, 375, 380, 506, 1338
SseBI	AGGCCT	1 cut(s)	563
SsiI	CCGC	5 cut(s)	279, 422, 638, 705, 888
SspMI	CTAG	4 cut(s)	758, 920, 990, 1089
StuI	AGGCCT	1 cut(s)	563
StyD4I	CCNGG	3 cut(s)	911, 944, 1342
StyI	CCWWGG	2 cut(s)	541, 989
TaaI	ACNGT	1 cut(s)	935
TaiI	ACGT	3 cut(s)	36, 980, 1377
TaqI	TCGA	5 cut(s)	66, 269, 344, 660, 1428
TasI	AATT	7 cut(s)	28, 118, 151, 375, 380, 506, 1338
TatI	WGTACW	1 cut(s)	187
TauI	GCSGC	2 cut(s)	425, 708
TfiI	GAWTC	3 cut(s)	111, 332, 551
Tru1I	TTAA	3 cut(s)	299, 486, 1253
Tru9I	TTAA	3 cut(s)	299, 486, 1253
TscAI	CASTG	5 cut(s)	220, 357, 500, 628, 1245
TseFI	GTSAC	2 cut(s)	23, 782
TseI	GCWGC	3 cut(s)	440, 1155, 1352
Tsp45I	GTSAC	2 cut(s)	23, 782
TspDTI	ATGAA	9 cut(s)	103, 166, 324, 518, 700, 728, 1037, 1207, 1252
TspGWI	ACGGA	3 cut(s)	159, 175, 469
TspRI	CASTG	5 cut(s)	220, 357, 500, 628, 1245
VpaK11BI	GGWCC	1 cut(s)	281
XapI	RAATTY	2 cut(s)	151, 506
XceI	RCATGY	1 cut(s)	20
XcmI	CCANNNNNNNNNTGG	1 cut(s)	741
XmaJI	CCTAGG	1 cut(s)	989
XspI	CTAG	4 cut(s)	758, 920, 990, 1089
Zsp2I	ATGCAT	2 cut(s)	646, 930

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.