Rmu_sc0002724.1_g000023

UDP-glucuronic acid decarboxylase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002724.1
Physical Location & Seq
Reverse (-)
127285 .. 128162
878 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002724.1_g000023.1.cds

Sequence Viewer

Length: 309 bp
atgagaatcttggttactggaggagctagattcattggttctcacctggttgacagattaatggaaaatgaaaagaatgaggttattgttgttgataactacttcactggctccaaggacaatcttaaaaaatggattggtcatcccagatttgagcttattcgtcatgatgtcactgaaacattgttggttgaggttgatcggatataccatcttgcatgcccagcttctccaattttctacaaatataatcctgtaaagtcatgtgattggaaatttgccatccttatccctgcaaaagctgtttga

Protein Analysis

102

Amino Acids

11.77

Weight (kDa)

8.6

Isoelectric Point (pI)

29.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 275
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 4 cut(s) 26, 157, 227, 302
AluI AGCT 4 cut(s) 26, 157, 227, 302
ApoI RAATTY 1 cut(s) 275
AseI ATTAAT 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 35
BccI CCATC 2 cut(s) 219, 290
BciT130I CCWGG 1 cut(s) 47
BfaI CTAG 1 cut(s) 27
Bme1390I CCNGG 1 cut(s) 47
BmiI GGNNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 47
BpmI CTGGAG 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 114
Bse1I ACTGG 2 cut(s) 22, 112
BseBI CCWGG 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 114
BseGI GGATG 2 cut(s) 142, 282
BseNI ACTGG 2 cut(s) 22, 112
BseRI GAGGAG 1 cut(s) 36
BseYI CCCAGC 1 cut(s) 223
Bsp143I GATC 1 cut(s) 199
BspHI TCATGA 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 112
BsrI ACTGG 2 cut(s) 22, 112
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 1 cut(s) 199
BssT1I CCWWGG 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 47
BstC8I GCNNGC 1 cut(s) 220
BstF5I GGATG 2 cut(s) 142, 282
BstKTI GATC 1 cut(s) 202
BstMBI GATC 1 cut(s) 199
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstNI CCWGG 1 cut(s) 47
BstNSI RCATGY 1 cut(s) 222
BstSCI CCNGG 1 cut(s) 45
BtsCI GGATG 2 cut(s) 142, 282
BtsIMutI CAGTG 2 cut(s) 105, 174
Cac8I GCNNGC 1 cut(s) 220
CciI TCATGA 1 cut(s) 166
CsiI ACCWGGT 1 cut(s) 45
CviAII CATG 3 cut(s) 167, 219, 264
CviJI RGCY 5 cut(s) 26, 111, 157, 227, 302
CviKI_1 RGCY 5 cut(s) 26, 111, 157, 227, 302
DpnI GATC 1 cut(s) 201
DpnII GATC 1 cut(s) 199
Eco130I CCWWGG 1 cut(s) 114
EcoRII CCWGG 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
FaeI CATG 3 cut(s) 170, 222, 267
FaiI YATR 5 cut(s) 168, 208, 220, 249, 265
FatI CATG 3 cut(s) 166, 218, 263
FokI GGATG 2 cut(s) 129, 269
FspBI CTAG 1 cut(s) 27
GsaI CCCAGC 1 cut(s) 227
GsuI CTGGAG 1 cut(s) 39
Hin1II CATG 3 cut(s) 170, 222, 267
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 2 cut(s) 6, 30
HphI GGTGA 1 cut(s) 35
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 204
Hpy188III TCNNGA 1 cut(s) 167
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4V TGCA 2 cut(s) 218, 296
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
Hsp92II CATG 3 cut(s) 170, 222, 267
Kzo9I GATC 1 cut(s) 199
LmnI GCTCC 2 cut(s) 23, 116
LpnPI CCDG 7 cut(s) 3, 32, 59, 93, 160, 237, 267
MabI ACCWGGT 1 cut(s) 45
MaeI CTAG 1 cut(s) 27
MaeIII GTNAC 2 cut(s) 13, 172
MalI GATC 1 cut(s) 201
MboI GATC 1 cut(s) 199
MluCI AATT 2 cut(s) 234, 275
MnlI CCTC 3 cut(s) 14, 73, 187
MseI TTAA 2 cut(s) 59, 126
MspR9I CCNGG 1 cut(s) 47
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 1 cut(s) 199
NlaIII CATG 3 cut(s) 170, 222, 267
NlaIV GGNNCC 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 172
NspI RCATGY 1 cut(s) 222
PaeI GCATGC 1 cut(s) 222
PagI TCATGA 1 cut(s) 166
PfeI GAWTC 2 cut(s) 6, 30
PshBI ATTAAT 1 cut(s) 59
Psp6I CCWGG 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 223
PspGI CCWGG 1 cut(s) 45
PspN4I GGNNCC 1 cut(s) 112
SaqAI TTAA 2 cut(s) 59, 126
Sau3AI GATC 1 cut(s) 199
ScrFI CCNGG 1 cut(s) 47
SetI ASST 7 cut(s) 28, 48, 84, 159, 198, 229, 304
SexAI ACCWGGT 1 cut(s) 45
SphI GCATGC 1 cut(s) 222
Sse9I AATT 2 cut(s) 234, 275
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 45
StyI CCWWGG 1 cut(s) 114
TasI AATT 2 cut(s) 234, 275
TfiI GAWTC 2 cut(s) 6, 30
Tru1I TTAA 2 cut(s) 59, 126
Tru9I TTAA 2 cut(s) 59, 126
TscAI CASTG 2 cut(s) 112, 181
TseFI GTSAC 1 cut(s) 172
Tsp45I GTSAC 1 cut(s) 172
TspDTI ATGAA 2 cut(s) 22, 84
TspRI CASTG 2 cut(s) 112, 181
VspI ATTAAT 1 cut(s) 59
XapI RAATTY 1 cut(s) 275
XceI RCATGY 1 cut(s) 222
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.