Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002841.1

Orthogroup ID

OG0005215

Physical Location & Seq

Genomic Coordinates Reverse (-)

44288 .. 47966

Gene Structure 3679 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002841.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1602 bp

atggcaggaggtggacatgcaccaccgcagaaacaggaggagttacagcctcatccagtaaaagatcagctaccaaacgtttcctactgcattaccagtcctcctccttggcctgaggctatcctacttggtttccaacattacttggtgatgcttggcacagcagttctcattcccacctatcttgttcctcagatgggaggaggaaatgaggagaaagcaaaaatgatccagactatactgtttgttgctggaatcaacacattgcagcagacattttttgggactcgtttacctgcagtaattggagcatcttatacctatgtcccaacaaccatttctattatcttggctggtcgatatagtgatgttgtgaatccccaggagaaattcgagaaaataatgcgtggaacccagggtgcactcattgttgcctctattctgcagattgttgttggtttcagtggcctttggcgcaatgtggctaggttccaaagtccactttctactgttcctttggttgctttgtcaggctttgggctctatgagcttggttttcctgtgtttgcaaaatgtgtggagattgggctaccacaactcatacttctactgatattttcacagtacatacctcatctgatgcgcagtgagacgcatgtctttgatcgctttgctgttttattttcggtgacaattgtgtggatttatgctcatctgctcaccgtgggcggggcttataagaacacaccagaagcaactcagttaacctgtcgaactgatcgtgctggcatcatacatgctgctccatggattagagttccatatcctttccaatggggagctcccacttttgatgctggagaagcttttgcaatgatgactgcttcatttgttgctcttgtagagtccaccggtgtctttattgctgtgtcaaggtatgcaagtgcaactccactcccacctgctattttaagtcgcggtattggttggcagggagtgggcattcttttctctggtatattcggcactgggaatggatcatcagtatctgttgaaaatgctggtttgttagctttgactcgagttggtagccgaagggttgtccaaatttcagccagcttcatgatcttcttttccatacttggaaaatttggagctgtctttgcctcgataccagcacccattgttgcagcaatgtattgcttcttcttcgcttatgttggctcagcaggtcttagcttgcttcagttttgcaatctaaacagtttcaggactaaatttatcataggcttctcaattttcatgggcctttcaataccacaatatttcaatgaatatacccttgttaaaggctatggtccggtgcacacaggagcaagatggttcaatgacatgatcaatgttccttttgcatcggagccatttgttgctggtttattggcatttgtcctggacaccacactgcatcgaaaggacgctgcgacgacgaaagacaggggcttgcgttggtgggacagattccgatcatacaagacagatacaagaagtgaggagttctattccttgcctttcaacctcaacaagtttttcccttcagtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005618 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005783 GO:0005886 GO:0005911 GO:0009506 GO:0012505 GO:0016020 GO:0030054 GO:0030312 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0055044 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Xan_ur_permease

Protein Analysis

533

Amino Acids

58.52

Weight (kDa)

9.22

Isoelectric Point (pI)

41.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005215)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G10540 AT1G10540 AT1G60030
fragaria_vesca	FvH4_4g34940 FvH4_4g34940 FvH4_4g34940 FvH4_4g34940 FvH4_4g34940
malus_domestica	MD13G1087500.v1.1 MD16G1088000.v1.1
prunus_persica	Prupe.1G258700_v2.0.a1 Prupe.1G258700_v2.0.a1 Prupe.1G258700_v2.0.a1
pyrus_communis	pycom13g07540 pycom16g07540
rosa_chinensis	RchiOBHm_Chr4g0444391
rosa_laevigata	RLG00000005835
rosa_multiflora	Rmu_sc0002841.1_g000007 Rmu_sc0019696.1_g000001
rosa_roxburghii	Rroxscaffold_5G00384920
rosa_rugosa	Rorug04G0352500 Rorug04G0352600 Rorug04G0352600 Rorug04G0352700 Rorug04G0352700 Rorug04G0352700
rosa_samantha	Rh4AG412800 Rh4BG424300
rosa_wichuraiana	Rw4G035460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	738
AarI	CACCTGC	1 cut(s)	970
Acc16I	TGCGCA	1 cut(s)	644
Acc36I	ACCTGC	3 cut(s)	304, 970, 1220
AccII	CGCG	1 cut(s)	978
AciI	CCGC	3 cut(s)	26, 729, 978
AclI	AACGTT	1 cut(s)	78
AclWI	GGATC	2 cut(s)	223, 1045
AcsI	RAATTY	4 cut(s)	389, 1107, 1148, 1277
AcuI	CTGAAG	2 cut(s)	1229, 1578
AfaI	GTAC	1 cut(s)	626
AfiI	CCNNNNNNNGG	2 cut(s)	197, 729
AgeI	ACCGGT	1 cut(s)	911
AgsI	TTSAA	5 cut(s)	1055, 1314, 1330, 1387, 1573
AjnI	CCWGG	3 cut(s)	381, 414, 1449
AjuI	GAANNNNNNNTTGG	2 cut(s)	322, 354
AluBI	AGCT	8 cut(s)	70, 550, 842, 866, 1073, 1119, 1157, 1239
AluI	AGCT	8 cut(s)	70, 550, 842, 866, 1073, 1119, 1157, 1239
Alw21I	GWGCWC	3 cut(s)	424, 844, 1368
Alw26I	GTCTC	1 cut(s)	644
Alw44I	GTGCAC	2 cut(s)	420, 1364
AlwI	GGATC	2 cut(s)	223, 1045
AlwNI	CAGNNNCTG	1 cut(s)	1049
Ama87I	CYCGRG	1 cut(s)	1080
AoxI	GGCC	3 cut(s)	110, 466, 1306
ApaLI	GTGCAC	2 cut(s)	420, 1364
ApeKI	GCWGC	4 cut(s)	268, 800, 1190, 1478
ApoI	RAATTY	4 cut(s)	389, 1107, 1148, 1277
AsiGI	ACCGGT	1 cut(s)	911
AspLEI	GCGC	2 cut(s)	477, 645
AspS9I	GGNCC	2 cut(s)	1306, 1358
AsuHPI	GGTGA	3 cut(s)	160, 700, 712
AvaI	CYCGRG	1 cut(s)	1080
AvaII	GGWCC	1 cut(s)	1358
AxyI	CCTNAGG	1 cut(s)	114
BaeGI	GKGCMC	2 cut(s)	424, 1368
BanII	GRGCYC	2 cut(s)	543, 844
BarI	GAAGNNNNNNTAC	2 cut(s)	1190, 1222
Bbv12I	GWGCWC	3 cut(s)	424, 844, 1368
BbvI	GCAGC	4 cut(s)	280, 787, 1202, 1465
BccI	CCATC	2 cut(s)	190, 1374
BciT130I	CCWGG	3 cut(s)	383, 416, 1451
BclI	TGATCA	1 cut(s)	1395
BcoDI	GTCTC	1 cut(s)	644
BfaI	CTAG	1 cut(s)	486
BfmI	CTRYAG	2 cut(s)	297, 443
BfuAI	ACCTGC	3 cut(s)	304, 970, 1220
BisI	GCNGC	4 cut(s)	269, 801, 1191, 1479
BlpI	GCTNAGC	1 cut(s)	1225
BlsI	GCNGC	4 cut(s)	270, 802, 1192, 1480
Bme1390I	CCNGG	3 cut(s)	383, 416, 1451
Bme18I	GGWCC	1 cut(s)	1358
BmeT110I	CYCGRG	1 cut(s)	1080
BmgT120I	GGNCC	2 cut(s)	1306, 1358
BmiI	GGNNCC	3 cut(s)	412, 491, 1419
BmrFI	CCNGG	3 cut(s)	383, 416, 1451
BmrI	ACTGGG	1 cut(s)	1038
BmsI	GCATC	7 cut(s)	141, 320, 630, 798, 844, 1421, 1474
BmuI	ACTGGG	1 cut(s)	1038
BoxI	GACNNNNGTC	1 cut(s)	656
BpmI	CTGGAG	1 cut(s)	879
Bpu1102I	GCTNAGC	1 cut(s)	1225
BsaBI	GATNNNNATC	1 cut(s)	1522
BsaJI	CCNNGG	6 cut(s)	107, 381, 414, 415, 723, 806
BsaWI	WCCGGW	2 cut(s)	911, 1360
BsaXI	ACNNNNNCTCC	2 cut(s)	85, 115
Bsc4I	CCNNNNNNNGG	2 cut(s)	197, 729
Bse118I	RCCGGY	1 cut(s)	911
Bse1I	ACTGG	3 cut(s)	56, 96, 1033
Bse21I	CCTNAGG	1 cut(s)	114
Bse3DI	GCAATG	4 cut(s)	263, 484, 879, 1200
Bse8I	GATNNNNATC	1 cut(s)	1522
BseBI	CCWGG	3 cut(s)	383, 416, 1451
BseDI	CCNNGG	6 cut(s)	107, 381, 414, 415, 723, 806
BseGI	GGATG	1 cut(s)	52
BseJI	GATNNNNATC	1 cut(s)	1522
BseLI	CCNNNNNNNGG	2 cut(s)	197, 729
BseMI	GCAATG	4 cut(s)	263, 484, 879, 1200
BseMII	CTCAG	4 cut(s)	105, 206, 773, 1239
BseNI	ACTGG	3 cut(s)	56, 96, 1033
BseRI	GAGGAG	5 cut(s)	53, 93, 216, 227, 1565
BseSI	GKGCMC	2 cut(s)	424, 1368
BseXI	GCAGC	4 cut(s)	280, 787, 1202, 1465
Bsh1236I	CGCG	1 cut(s)	978
BshFI	GGCC	3 cut(s)	112, 468, 1308
BshTI	ACCGGT	1 cut(s)	911
BsiHKAI	GWGCWC	3 cut(s)	424, 844, 1368
BsiHKCI	CYCGRG	1 cut(s)	1080
BsiSI	CCGG	2 cut(s)	912, 1361
BslFI	GGGAC	3 cut(s)	298, 311, 1526
BslI	CCNNNNNNNGG	2 cut(s)	197, 729
BsmAI	GTCTC	1 cut(s)	644
BsmBI	CGTCTC	1 cut(s)	644
BsmFI	GGGAC	3 cut(s)	298, 311, 1526
BsmI	GAATGC	1 cut(s)	1002
BsnI	GGCC	3 cut(s)	112, 468, 1308
BsoBI	CYCGRG	1 cut(s)	1080
Bsp1286I	GDGCHC	4 cut(s)	424, 543, 844, 1368
Bsp143I	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
Bsp1720I	GCTNAGC	1 cut(s)	1225
Bsp19I	CCATGG	1 cut(s)	806
BspACI	CCGC	3 cut(s)	26, 729, 978
BspANI	GGCC	3 cut(s)	112, 468, 1308
BspCNI	CTCAG	4 cut(s)	106, 205, 772, 1238
BspFNI	CGCG	1 cut(s)	978
BspHI	TCATGA	1 cut(s)	1122
BspLI	GGNNCC	3 cut(s)	412, 491, 1419
BspMAI	CTGCAG	2 cut(s)	301, 447
BspMI	ACCTGC	3 cut(s)	304, 970, 1220
BspPI	GGATC	2 cut(s)	223, 1045
BsrDI	GCAATG	4 cut(s)	263, 484, 879, 1200
BsrFI	RCCGGY	1 cut(s)	911
BsrI	ACTGG	3 cut(s)	56, 96, 1033
BssAI	RCCGGY	1 cut(s)	911
BssECI	CCNNGG	6 cut(s)	107, 381, 414, 415, 723, 806
BssMI	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
BssT1I	CCWWGG	2 cut(s)	107, 806
Bst2UI	CCWGG	3 cut(s)	383, 416, 1451
Bst4CI	ACNGT	5 cut(s)	243, 511, 624, 724, 1265
BstC8I	GCNNGC	4 cut(s)	787, 1117, 1241, 1502
BstDEI	CTNAG	5 cut(s)	114, 192, 759, 1225, 1235
BstDSI	CCRYGG	2 cut(s)	723, 806
BstF5I	GGATG	1 cut(s)	52
BstFNI	CGCG	1 cut(s)	978
BstHHI	GCGC	2 cut(s)	477, 645
BstKTI	GATC	8 cut(s)	67, 231, 667, 781, 1040, 1128, 1398, 1526
BstMAI	GTCTC	1 cut(s)	644
BstMBI	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
BstMWI	GCNNNNNNNGC	4 cut(s)	474, 547, 863, 1163
BstNI	CCWGG	3 cut(s)	383, 416, 1451
BstNSI	RCATGY	3 cut(s)	20, 659, 800
BstPAI	GACNNNNGTC	1 cut(s)	656
BstSCI	CCNGG	3 cut(s)	381, 414, 1449
BstSFI	CTRYAG	2 cut(s)	297, 443
BstSLI	GKGCMC	2 cut(s)	424, 1368
BstUI	CGCG	1 cut(s)	978
BstV1I	GCAGC	4 cut(s)	280, 787, 1202, 1465
Bsu36I	CCTNAGG	1 cut(s)	114
BsuRI	GGCC	3 cut(s)	112, 468, 1308
BtgI	CCRYGG	2 cut(s)	723, 806
BtsCI	GGATG	1 cut(s)	52
BtsI	GCAGTG	2 cut(s)	652, 1460
BtsIMutI	CAGTG	5 cut(s)	469, 652, 1026, 1460, 1602
BveI	ACCTGC	3 cut(s)	304, 970, 1220
Cac8I	GCNNGC	4 cut(s)	787, 1117, 1241, 1502
CaiI	CAGNNNCTG	1 cut(s)	1049
CciI	TCATGA	1 cut(s)	1122
CfoI	GCGC	2 cut(s)	477, 645
Cfr10I	RCCGGY	1 cut(s)	911
Cfr13I	GGNCC	2 cut(s)	1306, 1358
CseI	GACGC	2 cut(s)	661, 1484
Csp6I	GTAC	1 cut(s)	625
CspAI	ACCGGT	1 cut(s)	911
CspCI	CAANNNNNGTGG	4 cut(s)	166, 201, 558, 593
CviAII	CATG	7 cut(s)	17, 656, 797, 807, 1123, 1303, 1393
CviQI	GTAC	1 cut(s)	625
DdeI	CTNAG	5 cut(s)	114, 192, 759, 1225, 1235
DpnI	GATC	8 cut(s)	66, 230, 666, 780, 1039, 1127, 1397, 1525
DpnII	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
Ecl136II	GAGCTC	1 cut(s)	842
Eco130I	CCWWGG	2 cut(s)	107, 806
Eco24I	GRGCYC	2 cut(s)	543, 844
Eco47I	GGWCC	1 cut(s)	1358
Eco53kI	GAGCTC	1 cut(s)	842
Eco57I	CTGAAG	2 cut(s)	1229, 1578
Eco81I	CCTNAGG	1 cut(s)	114
Eco88I	CYCGRG	1 cut(s)	1080
EcoICRI	GAGCTC	1 cut(s)	842
EcoRII	CCWGG	3 cut(s)	381, 414, 1449
EcoT14I	CCWWGG	2 cut(s)	107, 806
EcoT38I	GRGCYC	2 cut(s)	543, 844
ErhI	CCWWGG	2 cut(s)	107, 806
Esp3I	CGTCTC	1 cut(s)	644
FaeI	CATG	7 cut(s)	20, 659, 800, 810, 1126, 1306, 1396
FaqI	GGGAC	3 cut(s)	298, 311, 1526
FatI	CATG	7 cut(s)	16, 655, 796, 806, 1122, 1302, 1392
FauI	CCCGC	1 cut(s)	722
FbaI	TGATCA	1 cut(s)	1395
Fnu4HI	GCNGC	4 cut(s)	269, 801, 1191, 1479
FokI	GGATG	1 cut(s)	39
FriOI	GRGCYC	2 cut(s)	543, 844
Fsp4HI	GCNGC	4 cut(s)	269, 801, 1191, 1479
FspBI	CTAG	1 cut(s)	486
FspI	TGCGCA	1 cut(s)	644
GlaI	GCGC	2 cut(s)	476, 644
GluI	GCNGC	4 cut(s)	269, 801, 1191, 1479
GsuI	CTGGAG	1 cut(s)	879
HaeIII	GGCC	3 cut(s)	112, 468, 1308
HapII	CCGG	2 cut(s)	912, 1361
HgaI	GACGC	2 cut(s)	661, 1484
HhaI	GCGC	2 cut(s)	477, 645
Hin1II	CATG	7 cut(s)	20, 659, 800, 810, 1126, 1306, 1396
Hin6I	GCGC	2 cut(s)	475, 643
HinP1I	GCGC	2 cut(s)	475, 643
HincII	GTYRAC	1 cut(s)	765
HindII	GTYRAC	1 cut(s)	765
HindIII	AAGCTT	1 cut(s)	864
HinfI	GANTC	6 cut(s)	255, 286, 376, 905, 1078, 1518
HpaI	GTTAAC	1 cut(s)	765
HpaII	CCGG	2 cut(s)	912, 1361
HphI	GGTGA	3 cut(s)	160, 700, 712
Hpy166II	GTNNAC	7 cut(s)	14, 293, 422, 500, 765, 909, 1366
Hpy188I	TCNGA	4 cut(s)	195, 639, 1417, 1523
Hpy188III	TCNNGA	4 cut(s)	232, 394, 1123, 1270
Hpy8I	GTNNAC	7 cut(s)	14, 293, 422, 500, 765, 909, 1366
Hpy99I	CGWCG	2 cut(s)	1486, 1489
HpyAV	CCTTC	2 cut(s)	1089, 1602
HpyCH4III	ACNGT	5 cut(s)	243, 511, 624, 724, 1265
HpyCH4IV	ACGT	1 cut(s)	78
HpyF10VI	GCNNNNNNNGC	4 cut(s)	474, 547, 863, 1163
HpyF3I	CTNAG	5 cut(s)	114, 192, 759, 1225, 1235
HpySE526I	ACGT	1 cut(s)	78
Hsp92II	CATG	7 cut(s)	20, 659, 800, 810, 1126, 1306, 1396
HspAI	GCGC	2 cut(s)	475, 643
Ksp22I	TGATCA	1 cut(s)	1395
KspAI	GTTAAC	1 cut(s)	765
Kzo9I	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
LmnI	GCTCC	7 cut(s)	308, 808, 839, 847, 1154, 1373, 1417
Lsp1109I	GCAGC	4 cut(s)	280, 787, 1202, 1465
LweI	GCATC	7 cut(s)	141, 320, 630, 798, 844, 1421, 1474
MaeI	CTAG	1 cut(s)	486
MaeII	ACGT	1 cut(s)	78
MaeIII	GTNAC	2 cut(s)	42, 688
MalI	GATC	8 cut(s)	66, 230, 666, 780, 1039, 1127, 1397, 1525
MboI	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
MboII	GAAGA	3 cut(s)	1120, 1198, 1201
MfeI	CAATTG	1 cut(s)	693
MhlI	GDGCHC	4 cut(s)	424, 543, 844, 1368
MluCI	AATT	7 cut(s)	303, 389, 693, 1107, 1148, 1277, 1296
MlyI	GAGTC	3 cut(s)	280, 914, 1072
MmeI	TCCRAC	1 cut(s)	160
MseI	TTAA	3 cut(s)	764, 971, 1347
MspI	CCGG	2 cut(s)	912, 1361
MspR9I	CCNGG	3 cut(s)	383, 416, 1451
MunI	CAATTG	1 cut(s)	693
Mva1269I	GAATGC	1 cut(s)	1002
MvaI	CCWGG	3 cut(s)	383, 416, 1451
MvnI	CGCG	1 cut(s)	978
MwoI	GCNNNNNNNGC	4 cut(s)	474, 547, 863, 1163
NcoI	CCATGG	1 cut(s)	806
NdeII	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
NlaIII	CATG	7 cut(s)	20, 659, 800, 810, 1126, 1306, 1396
NlaIV	GGNNCC	3 cut(s)	412, 491, 1419
NmuCI	GTSAC	1 cut(s)	688
NsbI	TGCGCA	1 cut(s)	644
NspI	RCATGY	3 cut(s)	20, 659, 800
PaeR7I	CTCGAG	1 cut(s)	1080
PagI	TCATGA	1 cut(s)	1122
PaqCI	CACCTGC	1 cut(s)	970
PasI	CCCWGGG	1 cut(s)	415
PcsI	WCGNNNNNNNCGW	1 cut(s)	778
PctI	GAATGC	1 cut(s)	1002
PfeI	GAWTC	3 cut(s)	255, 376, 1518
PfoI	TCCNGGA	1 cut(s)	1449
PinAI	ACCGGT	1 cut(s)	911
PkrI	GCNGC	4 cut(s)	270, 802, 1192, 1480
PleI	GAGTC	3 cut(s)	280, 913, 1072
PpsI	GAGTC	3 cut(s)	280, 913, 1072
PshAI	GACNNNNGTC	1 cut(s)	656
PsiI	TTATAA	1 cut(s)	738
Psp124BI	GAGCTC	1 cut(s)	844
Psp1406I	AACGTT	1 cut(s)	78
Psp6I	CCWGG	3 cut(s)	381, 414, 1449
PspGI	CCWGG	3 cut(s)	381, 414, 1449
PspN4I	GGNNCC	3 cut(s)	412, 491, 1419
PspPI	GGNCC	2 cut(s)	1306, 1358
PspXI	VCTCGAGB	1 cut(s)	1080
PstI	CTGCAG	2 cut(s)	301, 447
PstNI	CAGNNNCTG	1 cut(s)	1049
RsaI	GTAC	1 cut(s)	626
RsaNI	GTAC	1 cut(s)	625
SacI	GAGCTC	1 cut(s)	844
SaqAI	TTAA	3 cut(s)	764, 971, 1347
SatI	GCNGC	4 cut(s)	269, 801, 1191, 1479
Sau3AI	GATC	8 cut(s)	64, 228, 664, 778, 1037, 1125, 1395, 1523
Sau96I	GGNCC	2 cut(s)	1306, 1358
SchI	GAGTC	3 cut(s)	280, 914, 1072
ScrFI	CCNGG	3 cut(s)	383, 416, 1451
SduI	GDGCHC	4 cut(s)	424, 543, 844, 1368
SfaNI	GCATC	7 cut(s)	141, 320, 630, 798, 844, 1421, 1474
SfcI	CTRYAG	2 cut(s)	297, 443
Sfr274I	CTCGAG	1 cut(s)	1080
SgrAI	CRCCGGYG	1 cut(s)	911
SinI	GGWCC	1 cut(s)	1358
SlaI	CTCGAG	1 cut(s)	1080
SmlI	CTYRAG	1 cut(s)	1080
SmoI	CTYRAG	1 cut(s)	1080
Sse9I	AATT	7 cut(s)	303, 389, 693, 1107, 1148, 1277, 1296
SsiI	CCGC	3 cut(s)	26, 729, 978
SspI	AATATT	1 cut(s)	1325
SspMI	CTAG	1 cut(s)	486
SstI	GAGCTC	1 cut(s)	844
StyD4I	CCNGG	3 cut(s)	381, 414, 1449
StyI	CCWWGG	2 cut(s)	107, 806
TaaI	ACNGT	5 cut(s)	243, 511, 624, 724, 1265
TaiI	ACGT	1 cut(s)	81
TaqI	TCGA	6 cut(s)	358, 393, 772, 1081, 1169, 1468
TasI	AATT	7 cut(s)	303, 389, 693, 1107, 1148, 1277, 1296
TatI	WGTACW	1 cut(s)	624
TfiI	GAWTC	3 cut(s)	255, 376, 1518
Tru1I	TTAA	3 cut(s)	764, 971, 1347
Tru9I	TTAA	3 cut(s)	764, 971, 1347
TscAI	CASTG	5 cut(s)	469, 652, 1033, 1467, 1602
TseFI	GTSAC	1 cut(s)	688
TseI	GCWGC	4 cut(s)	268, 800, 1190, 1478
Tsp45I	GTSAC	1 cut(s)	688
TspDTI	ATGAA	4 cut(s)	876, 1111, 1291, 1347
TspRI	CASTG	5 cut(s)	469, 652, 1033, 1467, 1602
VneI	GTGCAC	2 cut(s)	420, 1364
VpaK11BI	GGWCC	1 cut(s)	1358
XapI	RAATTY	4 cut(s)	389, 1107, 1148, 1277
XceI	RCATGY	3 cut(s)	20, 659, 800
XhoI	CTCGAG	1 cut(s)	1080
XspI	CTAG	1 cut(s)	486

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.