Rmu_sc0002909.1_g000014

At4g15545-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002909.1
Physical Location & Seq
Reverse (-)
83469 .. 86881
3413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002909.1_g000014.1.cds

Sequence Viewer

Length: 1041 bp
atgtcgcagggaagcggaagcgtcggcggcggaggaggaggaggaggggggatggattttcagttgccggacgagatcttggcggtgattccgagcgacccgtacgagcagctggatctggcgcggaagatcacgtcgatggcgatagcggctagggtttcgaatctggaggcggaggtcgggaggctgaggcagaagctgagcgagaaagatagggttatttctgacctcgaggaaagagcctcgcgcctccagcatgttaaccacgacgccgattcgcggttgagaattgcgctggaggagaatatgaggctgtctaaagaacgagattcagtggcaatgaccgctaagaagcttagccgtgacttggcaaagttggaaacatttaagagacaactgatgcagtctctaaatgatgataattcatccccagccaaaactgttgatattggcacctgtgatcaatcggttccaaaggcatatccagataaggatgaggagacaaatggctactcagcccaatattcgtcaactggttctactgatatggggaacacaactgacgaagccttgaggaatgctgggcaaaagttttcgttgactccctatatcacacctcggcttactccaactggaactccaaagatcttttcgacaagtgggtcacctagagcatattctaccatcccatctcctcagcagacctctggtgccacatctcccacaaaatcatatgatggacggaattcagtgtcttcatggtacccatcaagccagcagtcatcagcagcaaactctccacctcgtggacgctcactgtcagggcgtactcctcgaattgatggaaaggagttctttcgtcaagccaggagccgcctatcatatgagcagttcagtgcatttctggctaacatcaaggagctaaatgctcaaaagcaaacccgggaggaaactctaaggaaagcagaggagatctttggaacagataacaaagatctatatttatcatttcaaggattgcttagccgcaacatacactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

346

Amino Acids

37.95

Weight (kDa)

8.78

Isoelectric Point (pI)

51.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012031)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 661
AbsI CCTCGAGG 1 cut(s) 230
Acc65I GGTACC 1 cut(s) 762
AccB1I GGYRCC 3 cut(s) 452, 710, 762
AccB7I CCANNNNNTGG 1 cut(s) 806
AccII CGCG 3 cut(s) 124, 247, 280
AclWI GGATC 1 cut(s) 123
AcsI RAATTY 1 cut(s) 745
AcyI GRCGYC 1 cut(s) 270
AdeI CACNNNGTG 1 cut(s) 806
AfaI GTAC 3 cut(s) 104, 764, 829
AfiI CCNNNNNNNGG 3 cut(s) 279, 367, 806
AgsI TTSAA 1 cut(s) 1013
AjiI CACGTC 1 cut(s) 135
AjnI CCWGG 1 cut(s) 866
AjuI GAANNNNNNNTTGG 2 cut(s) 634, 666
AluBI AGCT 4 cut(s) 112, 199, 355, 922
AluI AGCT 4 cut(s) 112, 199, 355, 922
Alw26I GTCTC 3 cut(s) 385, 411, 494
AlwI GGATC 1 cut(s) 123
AlwNI CAGNNNCTG 1 cut(s) 199
Ama87I CYCGRG 2 cut(s) 230, 942
ApeKI GCWGC 2 cut(s) 109, 788
ApoI RAATTY 1 cut(s) 745
Asp718I GGTACC 1 cut(s) 762
AspLEI GCGC 3 cut(s) 124, 249, 295
AsuC2I CCSGG 2 cut(s) 943, 944
AsuHPI GGTGA 2 cut(s) 97, 657
AsuII TTCGAA 1 cut(s) 161
AvaI CYCGRG 2 cut(s) 230, 942
BanI GGYRCC 3 cut(s) 452, 710, 762
BauI CACGAG 1 cut(s) 804
BbsI GAAGAC 1 cut(s) 747
BbvCI CCTCAGC 2 cut(s) 188, 696
BbvI GCAGC 2 cut(s) 121, 800
BccI CCATC 7 cut(s) 46, 133, 692, 697, 731, 775, 836
BceAI ACGGC 1 cut(s) 345
BciT130I CCWGG 1 cut(s) 868
BclI TGATCA 1 cut(s) 460
BcnI CCSGG 2 cut(s) 943, 944
BcoDI GTCTC 3 cut(s) 385, 411, 494
BfaI CTAG 3 cut(s) 153, 669, 1039
BglII AGATCT 4 cut(s) 75, 645, 972, 994
BisI GCNGC 6 cut(s) 28, 110, 150, 789, 874, 1027
BlpI GCTNAGC 3 cut(s) 200, 356, 1022
BlsI GCNGC 6 cut(s) 29, 111, 151, 790, 875, 1028
Bme1390I CCNGG 3 cut(s) 868, 943, 944
BmeT110I CYCGRG 2 cut(s) 230, 942
BmgBI CACGTC 1 cut(s) 135
BmiI GGNNCC 5 cut(s) 454, 471, 712, 764, 872
BmrFI CCNGG 3 cut(s) 868, 943, 944
BmsI GCATC 1 cut(s) 390
BpiI GAAGAC 1 cut(s) 747
BpmI CTGGAG 3 cut(s) 188, 236, 317
Bpu10I CCTNAGC 2 cut(s) 188, 696
Bpu1102I GCTNAGC 3 cut(s) 200, 356, 1022
Bpu14I TTCGAA 1 cut(s) 161
BpuEI CTTGAG 1 cut(s) 592
BpuMI CCSGG 2 cut(s) 943, 944
BsaHI GRCGYC 1 cut(s) 270
BsaJI CCNNGG 2 cut(s) 617, 942
BsaXI ACNNNNNCTCC 2 cut(s) 622, 652
Bsc4I CCNNNNNNNGG 3 cut(s) 279, 367, 806
Bse1I ACTGG 2 cut(s) 538, 637
Bse3DI GCAATG 1 cut(s) 345
BseBI CCWGG 1 cut(s) 868
BseDI CCNNGG 2 cut(s) 617, 942
BseGI GGATG 4 cut(s) 57, 425, 499, 684
BseLI CCNNNNNNNGG 3 cut(s) 279, 367, 806
BseMI GCAATG 1 cut(s) 345
BseMII CTCAG 4 cut(s) 179, 191, 528, 710
BseNI ACTGG 2 cut(s) 538, 637
BseRI GAGGAG 9 cut(s) 48, 51, 54, 57, 314, 512, 684, 822, 983
BseXI GCAGC 2 cut(s) 121, 800
BseYI CCCAGC 2 cut(s) 430, 581
Bsh1236I CGCG 3 cut(s) 124, 247, 280
BshNI GGYRCC 3 cut(s) 452, 710, 762
BsiHKCI CYCGRG 2 cut(s) 230, 942
BsiSI CCGG 2 cut(s) 68, 943
BsiWI CGTACG 1 cut(s) 102
BslI CCNNNNNNNGG 3 cut(s) 279, 367, 806
BsmAI GTCTC 3 cut(s) 385, 411, 494
BsmI GAATGC 1 cut(s) 583
BsoBI CYCGRG 2 cut(s) 230, 942
Bsp119I TTCGAA 1 cut(s) 161
Bsp143I GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
Bsp1720I GCTNAGC 3 cut(s) 200, 356, 1022
BspCNI CTCAG 4 cut(s) 180, 192, 527, 709
BspFNI CGCG 3 cut(s) 124, 247, 280
BspLI GGNNCC 5 cut(s) 454, 471, 712, 764, 872
BspPI GGATC 1 cut(s) 123
BspT104I TTCGAA 1 cut(s) 161
BspT107I GGYRCC 3 cut(s) 452, 710, 762
BsrDI GCAATG 1 cut(s) 345
BsrI ACTGG 2 cut(s) 538, 637
BssECI CCNNGG 2 cut(s) 617, 942
BssMI GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
BssNI GRCGYC 1 cut(s) 270
BssSI CACGAG 1 cut(s) 804
Bst2BI CACGAG 1 cut(s) 804
Bst2UI CCWGG 1 cut(s) 868
Bst4CI ACNGT 2 cut(s) 442, 819
BstACI GRCGYC 1 cut(s) 270
BstBI TTCGAA 1 cut(s) 161
BstC8I GCNNGC 1 cut(s) 776
BstDEI CTNAG 8 cut(s) 188, 200, 348, 356, 514, 696, 956, 1022
BstEII GGTNACC 1 cut(s) 663
BstF5I GGATG 4 cut(s) 57, 425, 499, 684
BstFNI CGCG 3 cut(s) 124, 247, 280
BstHHI GCGC 3 cut(s) 124, 249, 295
BstKTI GATC 7 cut(s) 78, 118, 132, 463, 648, 975, 997
BstMAI GTCTC 3 cut(s) 385, 411, 494
BstMBI GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
BstMWI GCNNNNNNNGC 5 cut(s) 27, 149, 253, 344, 905
BstNI CCWGG 1 cut(s) 868
BstNSI RCATGY 1 cut(s) 260
BstPI GGTNACC 1 cut(s) 663
BstSCI CCNGG 3 cut(s) 866, 941, 942
BstUI CGCG 3 cut(s) 124, 247, 280
BstV1I GCAGC 2 cut(s) 121, 800
BstV2I GAAGAC 1 cut(s) 747
BstX2I RGATCY 5 cut(s) 75, 115, 645, 972, 994
BstYI RGATCY 5 cut(s) 75, 115, 645, 972, 994
BtrI CACGTC 1 cut(s) 135
BtsCI GGATG 4 cut(s) 57, 425, 499, 684
BtsIMutI CAGTG 4 cut(s) 339, 756, 815, 901
Cac8I GCNNGC 1 cut(s) 776
CaiI CAGNNNCTG 1 cut(s) 199
CfoI GCGC 3 cut(s) 124, 249, 295
Cfr9I CCCGGG 1 cut(s) 942
CseI GACGC 3 cut(s) 10, 278, 819
Csp6I GTAC 3 cut(s) 103, 763, 828
CviAII CATG 2 cut(s) 257, 759
CviQI GTAC 3 cut(s) 103, 763, 828
DdeI CTNAG 8 cut(s) 188, 200, 348, 356, 514, 696, 956, 1022
DpnI GATC 7 cut(s) 77, 117, 131, 462, 647, 974, 996
DpnII GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
DraIII CACNNNGTG 1 cut(s) 806
DrdI GACNNNNNNGTC 1 cut(s) 661
DseDI GACNNNNNNGTC 1 cut(s) 661
EciI GGCGGA 2 cut(s) 45, 188
Eco88I CYCGRG 2 cut(s) 230, 942
Eco91I GGTNACC 1 cut(s) 663
EcoO65I GGTNACC 1 cut(s) 663
EcoRI GAATTC 1 cut(s) 745
EcoRII CCWGG 1 cut(s) 866
FaeI CATG 2 cut(s) 260, 762
FalI AAGNNNNNCTT 4 cut(s) 839, 871, 1005, 1037
FatI CATG 2 cut(s) 256, 758
FauNDI CATATG 2 cut(s) 733, 883
FbaI TGATCA 1 cut(s) 460
Fnu4HI GCNGC 6 cut(s) 28, 110, 150, 789, 874, 1027
FokI GGATG 4 cut(s) 64, 412, 506, 671
Fsp4HI GCNGC 6 cut(s) 28, 110, 150, 789, 874, 1027
FspBI CTAG 3 cut(s) 153, 669, 1039
GlaI GCGC 3 cut(s) 123, 248, 294
GluI GCNGC 6 cut(s) 28, 110, 150, 789, 874, 1027
GsaI CCCAGC 2 cut(s) 434, 585
GsuI CTGGAG 3 cut(s) 188, 236, 317
HapII CCGG 2 cut(s) 68, 943
HgaI GACGC 3 cut(s) 10, 278, 819
HhaI GCGC 3 cut(s) 124, 249, 295
Hin1I GRCGYC 1 cut(s) 270
Hin1II CATG 2 cut(s) 260, 762
Hin6I GCGC 3 cut(s) 122, 247, 293
HinP1I GCGC 3 cut(s) 122, 247, 293
HincII GTYRAC 3 cut(s) 262, 531, 600
HindII GTYRAC 3 cut(s) 262, 531, 600
HindIII AAGCTT 1 cut(s) 353
HinfI GANTC 5 cut(s) 88, 163, 275, 329, 601
HpaI GTTAAC 1 cut(s) 262
HpaII CCGG 2 cut(s) 68, 943
HphI GGTGA 2 cut(s) 97, 657
Hpy166II GTNNAC 4 cut(s) 262, 531, 600, 809
Hpy188I TCNGA 2 cut(s) 93, 226
Hpy188III TCNNGA 3 cut(s) 167, 181, 485
Hpy8I GTNNAC 4 cut(s) 262, 531, 600, 809
Hpy99I CGWCG 3 cut(s) 26, 139, 272
HpyCH4III ACNGT 2 cut(s) 442, 819
HpyCH4IV ACGT 1 cut(s) 134
HpyCH4V TGCA 2 cut(s) 403, 899
HpyF10VI GCNNNNNNNGC 5 cut(s) 27, 149, 253, 344, 905
HpyF3I CTNAG 8 cut(s) 188, 200, 348, 356, 514, 696, 956, 1022
HpySE526I ACGT 1 cut(s) 134
Hsp92I GRCGYC 1 cut(s) 270
Hsp92II CATG 2 cut(s) 260, 762
HspAI GCGC 3 cut(s) 122, 247, 293
KpnI GGTACC 1 cut(s) 766
Ksp22I TGATCA 1 cut(s) 460
KspAI GTTAAC 1 cut(s) 262
Kzo9I GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
LmnI GCTCC 2 cut(s) 870, 919
Lsp1109I GCAGC 2 cut(s) 121, 800
LweI GCATC 1 cut(s) 390
MaeI CTAG 3 cut(s) 153, 669, 1039
MaeII ACGT 1 cut(s) 134
MaeIII GTNAC 2 cut(s) 362, 663
MalI GATC 7 cut(s) 77, 117, 131, 462, 647, 974, 996
MboI GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
MboII GAAGA 2 cut(s) 139, 747
MflI RGATCY 5 cut(s) 75, 115, 645, 972, 994
MluCI AATT 4 cut(s) 288, 421, 745, 837
MlyI GAGTC 1 cut(s) 595
MmeI TCCRAC 2 cut(s) 357, 653
MseI TTAA 2 cut(s) 261, 387
MslI CAYNNNNRTG 1 cut(s) 137
MspA1I CMGCKG 1 cut(s) 112
MspI CCGG 2 cut(s) 68, 943
MspR9I CCNGG 3 cut(s) 868, 943, 944
Mva1269I GAATGC 1 cut(s) 583
MvaI CCWGG 1 cut(s) 868
MvnI CGCG 3 cut(s) 124, 247, 280
MwoI GCNNNNNNNGC 5 cut(s) 27, 149, 253, 344, 905
NciI CCSGG 2 cut(s) 943, 944
NdeI CATATG 2 cut(s) 733, 883
NdeII GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
NlaIII CATG 2 cut(s) 260, 762
NlaIV GGNNCC 5 cut(s) 454, 471, 712, 764, 872
NmeAIII GCCGAG 1 cut(s) 598
NmuCI GTSAC 2 cut(s) 362, 663
NspI RCATGY 1 cut(s) 260
NspV TTCGAA 1 cut(s) 161
PaeR7I CTCGAG 1 cut(s) 230
PcsI WCGNNNNNNNCGW 1 cut(s) 140
PctI GAATGC 1 cut(s) 583
PfeI GAWTC 4 cut(s) 88, 163, 275, 329
Pfl23II CGTACG 1 cut(s) 102
PflMI CCANNNNNTGG 1 cut(s) 806
PkrI GCNGC 6 cut(s) 29, 111, 151, 790, 875, 1028
PleI GAGTC 1 cut(s) 595
PpsI GAGTC 1 cut(s) 595
Psp6I CCWGG 1 cut(s) 866
PspEI GGTNACC 1 cut(s) 663
PspFI CCCAGC 2 cut(s) 430, 581
PspGI CCWGG 1 cut(s) 866
PspLI CGTACG 1 cut(s) 102
PspN4I GGNNCC 5 cut(s) 454, 471, 712, 764, 872
PspXI VCTCGAGB 1 cut(s) 230
PstNI CAGNNNCTG 1 cut(s) 199
PsuI RGATCY 5 cut(s) 75, 115, 645, 972, 994
PvuII CAGCTG 1 cut(s) 112
RsaI GTAC 3 cut(s) 104, 764, 829
RsaNI GTAC 3 cut(s) 103, 763, 828
RseI CAYNNNNRTG 1 cut(s) 137
SaqAI TTAA 2 cut(s) 261, 387
SatI GCNGC 6 cut(s) 28, 110, 150, 789, 874, 1027
Sau3AI GATC 7 cut(s) 75, 115, 129, 460, 645, 972, 994
SchI GAGTC 1 cut(s) 595
ScrFI CCNGG 3 cut(s) 868, 943, 944
SfaNI GCATC 1 cut(s) 390
Sfr274I CTCGAG 1 cut(s) 230
SfuI TTCGAA 1 cut(s) 161
SlaI CTCGAG 1 cut(s) 230
SmaI CCCGGG 1 cut(s) 944
SmiMI CAYNNNNRTG 1 cut(s) 137
SmlI CTYRAG 2 cut(s) 230, 571
SmoI CTYRAG 2 cut(s) 230, 571
Sse9I AATT 4 cut(s) 288, 421, 745, 837
SspI AATATT 1 cut(s) 524
SspMI CTAG 3 cut(s) 153, 669, 1039
StyD4I CCNGG 3 cut(s) 866, 941, 942
TaaI ACNGT 2 cut(s) 442, 819
TaiI ACGT 1 cut(s) 137
TaqI TCGA 5 cut(s) 137, 161, 231, 653, 835
TasI AATT 4 cut(s) 288, 421, 745, 837
TauI GCSGC 4 cut(s) 30, 152, 876, 1029
TfiI GAWTC 4 cut(s) 88, 163, 275, 329
Tru1I TTAA 2 cut(s) 261, 387
Tru9I TTAA 2 cut(s) 261, 387
TscAI CASTG 4 cut(s) 339, 756, 822, 901
TseFI GTSAC 2 cut(s) 362, 663
TseI GCWGC 2 cut(s) 109, 788
Tsp45I GTSAC 2 cut(s) 362, 663
TspDTI ATGAA 2 cut(s) 414, 747
TspGWI ACGGA 1 cut(s) 757
TspMI CCCGGG 1 cut(s) 942
TspRI CASTG 4 cut(s) 339, 756, 822, 901
Van91I CCANNNNNTGG 1 cut(s) 806
XapI RAATTY 1 cut(s) 745
XceI RCATGY 1 cut(s) 260
XhoI CTCGAG 1 cut(s) 230
XmaI CCCGGG 1 cut(s) 942
XspI CTAG 3 cut(s) 153, 669, 1039
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.