Rmu_sc0003130.1_g000014

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003130.1
OG0015722
Physical Location & Seq
Forward (+)
62180 .. 66675
4496 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 660 bp
atgaggagagatgagataaccttttataggtggggaagaggccgagctcttccatgttttcgatgtggggatgaagtgcttcagttcccagcttttggggcttctgatgctatcttggcatggcgcgtcagcgctgatctgggggtgagctggggcttacgcggtagcctgcttggctgtgtttccaatcatccccaaattgtgtttctatgcgagacaaaggtcagtaggaaggaagatttccaagcattgcaattgtctctagggtttcctctttctgtagaggtcctcagtgatggtcagtcaggagggttggcattgttttggtgtgcggaggtggatatccaaccccttacaaagtctgtgcatcatattgacgtggaggtgtgcggtggaccaggtgagccacaatggagattatctggtttctatgggtatgagcgcatggctgagcgtgacaaatcatggcaactgttgaaggatcttagtgatcttgactctctcccttgggttgtaatcggggacttcaatgaaatactaaacaatggagagaagattgatgggcttccaagagctgaacggcagatgagaggtttcagagaggctttaggttattgtgagttgttggatcttgggtttcaaggttctagggaaacatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

219

Amino Acids

24.58

Weight (kDa)

4.98

Isoelectric Point (pI)

32.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Exo_endo_phos PF03372 63 - 194 7.9e-10 Endonuclease/Exonuclease/phosphatase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 95
AccII CGCG 2 cut(s) 126, 162
AciI CCGC 3 cut(s) 162, 332, 390
AclWI GGATC 2 cut(s) 489, 636
AcuI CTGAAG 1 cut(s) 65
AfeI AGCGCT 1 cut(s) 133
AfiI CCNNNNNNNGG 2 cut(s) 27, 95
AgsI TTSAA 3 cut(s) 478, 529, 641
AjiI CACGTC 1 cut(s) 379
AjnI CCWGG 1 cut(s) 397
AjuI GAANNNNNNNTTGG 2 cut(s) 189, 221
AluBI AGCT 4 cut(s) 47, 92, 150, 575
AluI AGCT 4 cut(s) 47, 92, 150, 575
Alw21I GWGCWC 1 cut(s) 49
Alw26I GTCTC 2 cut(s) 209, 264
AlwI GGATC 2 cut(s) 489, 636
Aor51HI AGCGCT 1 cut(s) 133
AoxI GGCC 1 cut(s) 40
Asp700I GAANNNNTTC 1 cut(s) 78
AspLEI GCGC 3 cut(s) 126, 134, 444
AspS9I GGNCC 2 cut(s) 286, 395
AsuHPI GGTGA 2 cut(s) 157, 413
AvaII GGWCC 2 cut(s) 286, 395
BanII GRGCYC 1 cut(s) 49
Bbv12I GWGCWC 1 cut(s) 49
BccI CCATC 2 cut(s) 290, 554
BceAI ACGGC 1 cut(s) 596
BciT130I CCWGG 1 cut(s) 399
BcoDI GTCTC 2 cut(s) 209, 264
BfaI CTAG 2 cut(s) 263, 648
BfmI CTRYAG 1 cut(s) 279
BfoI RGCGCY 1 cut(s) 135
BglI GCCNNNNNGGC 1 cut(s) 174
BlpI GCTNAGC 1 cut(s) 450
Bme1390I CCNGG 1 cut(s) 399
Bme18I GGWCC 2 cut(s) 286, 395
BmgBI CACGTC 1 cut(s) 379
BmgT120I GGNCC 2 cut(s) 286, 395
BmrFI CCNGG 1 cut(s) 399
BmsI GCATC 2 cut(s) 97, 376
BoxI GACNNNNGTC 1 cut(s) 221
Bpu1102I GCTNAGC 1 cut(s) 450
BsaJI CCNNGG 1 cut(s) 506
Bsc4I CCNNNNNNNGG 2 cut(s) 27, 95
Bse3DI GCAATG 1 cut(s) 248
BseBI CCWGG 1 cut(s) 399
BseDI CCNNGG 1 cut(s) 506
BseGI GGATG 2 cut(s) 76, 190
BseLI CCNNNNNNNGG 2 cut(s) 27, 95
BseMI GCAATG 1 cut(s) 248
BseMII CTCAG 2 cut(s) 304, 441
BseRI GAGGAG 1 cut(s) 19
BseYI CCCAGC 2 cut(s) 88, 150
Bsh1236I CGCG 2 cut(s) 126, 162
BshFI GGCC 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 49
BslFI GGGAC 1 cut(s) 536
BslI CCNNNNNNNGG 2 cut(s) 27, 95
BsmAI GTCTC 2 cut(s) 209, 264
BsmFI GGGAC 1 cut(s) 536
BsnI GGCC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 49
Bsp143I GATC 4 cut(s) 136, 481, 490, 628
Bsp1720I GCTNAGC 1 cut(s) 450
BspACI CCGC 3 cut(s) 162, 332, 390
BspANI GGCC 1 cut(s) 42
BspCNI CTCAG 2 cut(s) 303, 442
BspFNI CGCG 2 cut(s) 126, 162
BspPI GGATC 2 cut(s) 489, 636
BspQI GCTCTTC 1 cut(s) 54
BsrDI GCAATG 1 cut(s) 248
BssECI CCNNGG 1 cut(s) 506
BssMI GATC 4 cut(s) 136, 481, 490, 628
BssT1I CCWWGG 1 cut(s) 506
Bst2UI CCWGG 1 cut(s) 399
Bst4CI ACNGT 1 cut(s) 474
Bst6I CTCTTC 2 cut(s) 31, 54
BstC8I GCNNGC 1 cut(s) 170
BstDEI CTNAG 3 cut(s) 290, 450, 485
BstENI CCTNNNNNAGG 1 cut(s) 25
BstF5I GGATG 2 cut(s) 76, 190
BstFNI CGCG 2 cut(s) 126, 162
BstH2I RGCGCY 1 cut(s) 135
BstHHI GCGC 3 cut(s) 126, 134, 444
BstKTI GATC 4 cut(s) 139, 484, 493, 631
BstMAI GTCTC 2 cut(s) 209, 264
BstMBI GATC 4 cut(s) 136, 481, 490, 628
BstMWI GCNNNNNNNGC 4 cut(s) 98, 107, 116, 174
BstNI CCWGG 1 cut(s) 399
BstPAI GACNNNNGTC 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 397
BstSFI CTRYAG 1 cut(s) 279
BstUI CGCG 2 cut(s) 126, 162
BstX2I RGATCY 2 cut(s) 481, 628
BstYI RGATCY 2 cut(s) 481, 628
BsuRI GGCC 1 cut(s) 42
BtrI CACGTC 1 cut(s) 379
BtsCI GGATG 2 cut(s) 76, 190
BtsIMutI CAGTG 1 cut(s) 298
Cac8I GCNNGC 1 cut(s) 170
CfoI GCGC 3 cut(s) 126, 134, 444
Cfr13I GGNCC 2 cut(s) 286, 395
CseI GACGC 1 cut(s) 115
CsiI ACCWGGT 1 cut(s) 397
CviAII CATG 4 cut(s) 54, 120, 445, 465
DdeI CTNAG 3 cut(s) 290, 450, 485
DpnI GATC 4 cut(s) 138, 483, 492, 630
DpnII GATC 4 cut(s) 136, 481, 490, 628
Eam1104I CTCTTC 2 cut(s) 31, 54
EarI CTCTTC 2 cut(s) 31, 54
Ecl136II GAGCTC 1 cut(s) 47
Eco130I CCWWGG 1 cut(s) 506
Eco24I GRGCYC 1 cut(s) 49
Eco32I GATATC 1 cut(s) 343
Eco47I GGWCC 2 cut(s) 286, 395
Eco47III AGCGCT 1 cut(s) 133
Eco53kI GAGCTC 1 cut(s) 47
Eco57I CTGAAG 1 cut(s) 65
EcoICRI GAGCTC 1 cut(s) 47
EcoNI CCTNNNNNAGG 1 cut(s) 25
EcoO109I RGGNCCY 1 cut(s) 286
EcoRII CCWGG 1 cut(s) 397
EcoRV GATATC 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 506
EcoT38I GRGCYC 1 cut(s) 49
ErhI CCWWGG 1 cut(s) 506
FaeI CATG 4 cut(s) 57, 123, 448, 468
FaqI GGGAC 1 cut(s) 536
FatI CATG 4 cut(s) 53, 119, 444, 464
FokI GGATG 2 cut(s) 83, 177
FriOI GRGCYC 1 cut(s) 49
FspBI CTAG 2 cut(s) 263, 648
GlaI GCGC 3 cut(s) 125, 133, 443
GsaI CCCAGC 2 cut(s) 92, 154
HaeII RGCGCY 1 cut(s) 135
HaeIII GGCC 1 cut(s) 42
HgaI GACGC 1 cut(s) 115
HhaI GCGC 3 cut(s) 126, 134, 444
Hin1II CATG 4 cut(s) 57, 123, 448, 468
Hin6I GCGC 3 cut(s) 124, 132, 442
HinP1I GCGC 3 cut(s) 124, 132, 442
HinfI GANTC 1 cut(s) 497
HphI GGTGA 2 cut(s) 157, 413
Hpy166II GTNNAC 1 cut(s) 395
Hpy188I TCNGA 2 cut(s) 106, 599
Hpy188III TCNNGA 2 cut(s) 306, 494
Hpy8I GTNNAC 1 cut(s) 395
HpyAV CCTTC 2 cut(s) 226, 472
HpyCH4III ACNGT 1 cut(s) 474
HpyCH4IV ACGT 1 cut(s) 378
HpyCH4V TGCA 2 cut(s) 253, 367
HpyF10VI GCNNNNNNNGC 4 cut(s) 98, 107, 116, 174
HpyF3I CTNAG 3 cut(s) 290, 450, 485
HpySE526I ACGT 1 cut(s) 378
Hsp92II CATG 4 cut(s) 57, 123, 448, 468
HspAI GCGC 3 cut(s) 124, 132, 442
Kzo9I GATC 4 cut(s) 136, 481, 490, 628
LguI GCTCTTC 1 cut(s) 54
LpnPI CCDG 8 cut(s) 102, 125, 136, 182, 291, 384, 408, 411
LweI GCATC 2 cut(s) 97, 376
MabI ACCWGGT 1 cut(s) 397
MaeI CTAG 2 cut(s) 263, 648
MaeII ACGT 1 cut(s) 378
MaeIII GTNAC 1 cut(s) 455
MalI GATC 4 cut(s) 138, 483, 492, 630
MboI GATC 4 cut(s) 136, 481, 490, 628
MboII GAAGA 4 cut(s) 41, 48, 248, 565
MfeI CAATTG 1 cut(s) 254
MflI RGATCY 2 cut(s) 481, 628
MhlI GDGCHC 1 cut(s) 49
MluCI AATT 2 cut(s) 198, 254
MlyI GAGTC 1 cut(s) 491
MmeI TCCRAC 2 cut(s) 370, 606
MnlI CCTC 9 cut(s) 32, 277, 282, 299, 302, 328, 376, 584, 595
MroXI GAANNNNTTC 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 399
MunI CAATTG 1 cut(s) 254
MvaI CCWGG 1 cut(s) 399
MvnI CGCG 2 cut(s) 126, 162
MwoI GCNNNNNNNGC 4 cut(s) 98, 107, 116, 174
NdeII GATC 4 cut(s) 136, 481, 490, 628
NlaIII CATG 4 cut(s) 57, 123, 448, 468
NmeAIII GCCGAG 1 cut(s) 68
NmuCI GTSAC 1 cut(s) 455
PciSI GCTCTTC 1 cut(s) 54
PdmI GAANNNNTTC 1 cut(s) 78
PflMI CCANNNNNTGG 1 cut(s) 95
PleI GAGTC 1 cut(s) 491
PpsI GAGTC 1 cut(s) 491
PpuMI RGGWCCY 1 cut(s) 286
PshAI GACNNNNGTC 1 cut(s) 221
Psp124BI GAGCTC 1 cut(s) 49
Psp5II RGGWCCY 1 cut(s) 286
Psp6I CCWGG 1 cut(s) 397
PspFI CCCAGC 2 cut(s) 88, 150
PspGI CCWGG 1 cut(s) 397
PspPI GGNCC 2 cut(s) 286, 395
PspPPI RGGWCCY 1 cut(s) 286
PsuI RGATCY 2 cut(s) 481, 628
SacI GAGCTC 1 cut(s) 49
SapI GCTCTTC 1 cut(s) 54
Sau3AI GATC 4 cut(s) 136, 481, 490, 628
Sau96I GGNCC 2 cut(s) 286, 395
SchI GAGTC 1 cut(s) 491
ScrFI CCNGG 1 cut(s) 399
SduI GDGCHC 1 cut(s) 49
SexAI ACCWGGT 1 cut(s) 397
SfaNI GCATC 2 cut(s) 97, 376
SfcI CTRYAG 1 cut(s) 279
SinI GGWCC 2 cut(s) 286, 395
Sse9I AATT 2 cut(s) 198, 254
SsiI CCGC 3 cut(s) 162, 332, 390
SspMI CTAG 2 cut(s) 263, 648
SstI GAGCTC 1 cut(s) 49
StyD4I CCNGG 1 cut(s) 397
StyI CCWWGG 1 cut(s) 506
TaaI ACNGT 1 cut(s) 474
TaiI ACGT 1 cut(s) 381
TaqI TCGA 1 cut(s) 61
TasI AATT 2 cut(s) 198, 254
TscAI CASTG 1 cut(s) 298
TseFI GTSAC 1 cut(s) 455
Tsp45I GTSAC 1 cut(s) 455
TspDTI ATGAA 2 cut(s) 87, 546
TspRI CASTG 1 cut(s) 298
Van91I CCANNNNNTGG 1 cut(s) 95
VpaK11BI GGWCC 2 cut(s) 286, 395
XagI CCTNNNNNAGG 1 cut(s) 25
XmnI GAANNNNTTC 1 cut(s) 78
XspI CTAG 2 cut(s) 263, 648
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.