Rmu_sc0003306.1_g000008

Phospholipid diacylglycerol acyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003306.1
OG0011775
Physical Location & Seq
Forward (+)
41787 .. 43601
1815 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003306.1_g000008.1.cds

Sequence Viewer

Length: 1053 bp
atggctgcttcaattcttcggcttcgcaagctgtgctatgttcagcctgtgaggttttcgacattgtgctttcagtcctttgaaacagccaaggacgagggtgctgaaactccgaagttcgaaaatgaagtgaaagagaaacagaggattaagaacaagaacaagaggcaaccgagggaatggagatgcatacataactgttgttggataattgggtccatgtgtacaacttggtggcttcttttgtttttgtacaacaccttgccaactgcattgactggttttcaggtgccagaatcacctggaacaaggcttaggcgcgaaggtgtgccagaatcacctggaacaaggcttaggcgcgaaggtgtaagcctccttcacccagttgtcatggtccctggcattgtaaccggtggcctagagctctgggagggcaggccttgtgctgaaggtctttttaggaagcgactttggggtggtagtttctcagagatcttcaaaaggcctatgtgtttgttggagcacctatcactggacaatgaaacagggctggaccctccaggaattcgagtcagagcagttcggggactcgctgcagctgactattttgctcctggctactttgtttgggctgtcctcattaagaatttggcaaaaattggttatgaagggaagaacatgcatatggctgcctatgattggaggctttctttccagaacactgagattcgggaccaagctcttagtaggttgaagagtaaaattgagcttatgtatgcaatcaatggccataagaaagtggtcgtggtgcctcattctatgggggctatttattttctccacttcatgaaatgggtcgagtcacctcctcctatgggaggtggtggtggtccaagttggtgtgccacgcacatcaaagcaatcatgaatatcggtccagcatttcttggtgttccaagagcagttagtaatatattttctgctgagggtaaagatgttgcttacatcaggtttgtctatgtgttcaatttctcatgtgtgtttgcattctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00561 map00561
Pfam Domains
Protein Families
LCAT Lipase_GDSL

Protein Analysis

350

Amino Acids

39.61

Weight (kDa)

9.51

Isoelectric Point (pI)

47.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011775)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G44830
fragaria_vesca FvH4_3g30050
malus_domestica MD11G1154200.v1.1
prunus_persica Prupe.6G116700_v2.0.a1 Prupe.6G116700_v2.0.a1
pyrus_communis pycom11g12590
rosa_chinensis RchiOBHm_Chr5g0055851 RchiOBHm_Chr5g0055861
rosa_laevigata RLG00000035014
rosa_multiflora Rmu_sc0003306.1_g000008
rosa_roxburghii Rroxscaffold_1G00024510
rosa_rugosa Rorug05G0295200 Rorug05G0295200 Rorug05G0295300
rosa_samantha Rh5AG366600 Rh5BG376800 Rh5CG399800 Rh5DG389800
rosa_wichuraiana Rw5G034360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 289, 808
AccII CGCG 2 cut(s) 321, 360
AcoI YGGCCR 1 cut(s) 787
AcsI RAATTY 2 cut(s) 564, 646
AcuI CTGAAG 1 cut(s) 468
AfaI GTAC 2 cut(s) 226, 254
AfiI CCNNNNNNNGG 4 cut(s) 532, 699, 875, 878
AgeI ACCGGT 1 cut(s) 410
AgsI TTSAA 5 cut(s) 12, 83, 499, 754, 1027
AjnI CCWGG 5 cut(s) 301, 340, 397, 559, 613
AluBI AGCT 5 cut(s) 31, 424, 599, 740, 769
AluI AGCT 5 cut(s) 31, 424, 599, 740, 769
Alw21I GWGCWC 2 cut(s) 426, 525
AoxI GGCC 4 cut(s) 415, 437, 503, 787
ApeKI GCWGC 4 cut(s) 5, 593, 596, 689
ApoI RAATTY 2 cut(s) 564, 646
AsiGI ACCGGT 1 cut(s) 410
AspLEI GCGC 2 cut(s) 321, 360
AspS9I GGNCC 6 cut(s) 216, 394, 553, 733, 890, 935
AsuHPI GGTGA 4 cut(s) 291, 330, 371, 855
AsuII TTCGAA 1 cut(s) 120
AvaII GGWCC 6 cut(s) 216, 394, 553, 733, 890, 935
BalI TGGCCA 1 cut(s) 789
BanI GGYRCC 2 cut(s) 289, 808
BanII GRGCYC 1 cut(s) 426
BarI GAAGNNNNNNTAC 2 cut(s) 360, 392
Bbv12I GWGCWC 2 cut(s) 426, 525
BbvCI CCTCAGC 1 cut(s) 984
BbvI GCAGC 3 cut(s) 580, 608, 676
BciT130I CCWGG 5 cut(s) 303, 342, 399, 561, 615
BfaI CTAG 1 cut(s) 419
BfmI CTRYAG 1 cut(s) 594
BglII AGATCT 1 cut(s) 492
BisI GCNGC 4 cut(s) 6, 594, 597, 690
BlsI GCNGC 4 cut(s) 7, 595, 598, 691
Bme1390I CCNGG 5 cut(s) 303, 342, 399, 561, 615
Bme18I GGWCC 6 cut(s) 216, 394, 553, 733, 890, 935
BmgT120I GGNCC 6 cut(s) 216, 394, 553, 733, 890, 935
BmiI GGNNCC 6 cut(s) 217, 291, 396, 555, 734, 810
BmrFI CCNGG 5 cut(s) 303, 342, 399, 561, 615
BmrI ACTGGG 1 cut(s) 377
BmsI GCATC 1 cut(s) 176
BmuI ACTGGG 1 cut(s) 377
BpmI CTGGAG 1 cut(s) 543
Bpu10I CCTNAGC 3 cut(s) 314, 353, 984
Bpu14I TTCGAA 1 cut(s) 120
BsaJI CCNNGG 3 cut(s) 90, 173, 397
BsaWI WCCGGW 1 cut(s) 410
Bsc4I CCNNNNNNNGG 4 cut(s) 532, 699, 875, 878
Bse118I RCCGGY 1 cut(s) 410
Bse1I ACTGG 3 cut(s) 283, 383, 537
BseBI CCWGG 5 cut(s) 303, 342, 399, 561, 615
BseDI CCNNGG 3 cut(s) 90, 173, 397
BseLI CCNNNNNNNGG 4 cut(s) 532, 699, 875, 878
BseMII CTCAG 3 cut(s) 501, 714, 975
BseNI ACTGG 3 cut(s) 283, 383, 537
BseRI GAGGAG 1 cut(s) 858
BseXI GCAGC 3 cut(s) 580, 608, 676
Bsh1236I CGCG 2 cut(s) 321, 360
BshFI GGCC 4 cut(s) 417, 439, 505, 789
BshNI GGYRCC 2 cut(s) 289, 808
BshTI ACCGGT 1 cut(s) 410
BsiHKAI GWGCWC 2 cut(s) 426, 525
BsiSI CCGG 1 cut(s) 411
BslFI GGGAC 3 cut(s) 380, 600, 746
BslI CCNNNNNNNGG 4 cut(s) 532, 699, 875, 878
BsmFI GGGAC 3 cut(s) 380, 600, 746
BsmI GAATGC 1 cut(s) 1046
BsnI GGCC 4 cut(s) 417, 439, 505, 789
Bsp119I TTCGAA 1 cut(s) 120
Bsp1286I GDGCHC 2 cut(s) 426, 525
Bsp1407I TGTACA 2 cut(s) 224, 252
Bsp143I GATC 1 cut(s) 492
BspANI GGCC 4 cut(s) 417, 439, 505, 789
BspCNI CTCAG 3 cut(s) 500, 715, 976
BspFNI CGCG 2 cut(s) 321, 360
BspHI TCATGA 2 cut(s) 846, 924
BspLI GGNNCC 6 cut(s) 217, 291, 396, 555, 734, 810
BspMAI CTGCAG 1 cut(s) 598
BspT104I TTCGAA 1 cut(s) 120
BspT107I GGYRCC 2 cut(s) 289, 808
BsrFI RCCGGY 1 cut(s) 410
BsrGI TGTACA 2 cut(s) 224, 252
BsrI ACTGG 3 cut(s) 283, 383, 537
BssAI RCCGGY 1 cut(s) 410
BssECI CCNNGG 3 cut(s) 90, 173, 397
BssMI GATC 1 cut(s) 492
BssT1I CCWWGG 1 cut(s) 90
Bst2UI CCWGG 5 cut(s) 303, 342, 399, 561, 615
Bst4CI ACNGT 1 cut(s) 200
Bst6I CTCTTC 1 cut(s) 749
BstAPI GCANNNNNTGC 1 cut(s) 33
BstAUI TGTACA 2 cut(s) 224, 252
BstBI TTCGAA 1 cut(s) 120
BstC8I GCNNGC 2 cut(s) 29, 437
BstDEI CTNAG 6 cut(s) 314, 353, 487, 723, 743, 984
BstENI CCTNNNNNAGG 1 cut(s) 876
BstFNI CGCG 2 cut(s) 321, 360
BstHHI GCGC 2 cut(s) 321, 360
BstKTI GATC 1 cut(s) 495
BstMBI GATC 1 cut(s) 492
BstMWI GCNNNNNNNGC 2 cut(s) 28, 33
BstNI CCWGG 5 cut(s) 303, 342, 399, 561, 615
BstNSI RCATGY 1 cut(s) 682
BstSCI CCNGG 5 cut(s) 301, 340, 397, 559, 613
BstSFI CTRYAG 1 cut(s) 594
BstUI CGCG 2 cut(s) 321, 360
BstV1I GCAGC 3 cut(s) 580, 608, 676
BstX2I RGATCY 1 cut(s) 492
BstYI RGATCY 1 cut(s) 492
BsuRI GGCC 4 cut(s) 417, 439, 505, 789
BtsIMutI CAGTG 2 cut(s) 530, 720
Cac8I GCNNGC 2 cut(s) 29, 437
CciI TCATGA 2 cut(s) 846, 924
CfoI GCGC 2 cut(s) 321, 360
Cfr10I RCCGGY 1 cut(s) 410
Cfr13I GGNCC 6 cut(s) 216, 394, 553, 733, 890, 935
Csp6I GTAC 2 cut(s) 225, 253
CspAI ACCGGT 1 cut(s) 410
CviAII CATG 6 cut(s) 220, 391, 679, 847, 925, 1035
CviQI GTAC 2 cut(s) 225, 253
DdeI CTNAG 6 cut(s) 314, 353, 487, 723, 743, 984
DpnI GATC 1 cut(s) 494
DpnII GATC 1 cut(s) 492
EaeI YGGCCR 1 cut(s) 787
Eam1104I CTCTTC 1 cut(s) 749
EarI CTCTTC 1 cut(s) 749
Ecl136II GAGCTC 1 cut(s) 424
Eco130I CCWWGG 1 cut(s) 90
Eco147I AGGCCT 2 cut(s) 439, 505
Eco24I GRGCYC 1 cut(s) 426
Eco47I GGWCC 6 cut(s) 216, 394, 553, 733, 890, 935
Eco53kI GAGCTC 1 cut(s) 424
Eco57I CTGAAG 1 cut(s) 468
EcoICRI GAGCTC 1 cut(s) 424
EcoNI CCTNNNNNAGG 1 cut(s) 876
EcoRI GAATTC 1 cut(s) 564
EcoRII CCWGG 5 cut(s) 301, 340, 397, 559, 613
EcoT14I CCWWGG 1 cut(s) 90
EcoT22I ATGCAT 2 cut(s) 191, 684
EcoT38I GRGCYC 1 cut(s) 426
ErhI CCWWGG 1 cut(s) 90
FaeI CATG 6 cut(s) 223, 394, 682, 850, 928, 1038
FaqI GGGAC 3 cut(s) 380, 600, 746
FatI CATG 6 cut(s) 219, 390, 678, 846, 924, 1034
FauNDI CATATG 1 cut(s) 684
Fnu4HI GCNGC 4 cut(s) 6, 594, 597, 690
FriOI GRGCYC 1 cut(s) 426
Fsp4HI GCNGC 4 cut(s) 6, 594, 597, 690
FspBI CTAG 1 cut(s) 419
GlaI GCGC 2 cut(s) 320, 359
GluI GCNGC 4 cut(s) 6, 594, 597, 690
GsuI CTGGAG 1 cut(s) 543
HaeIII GGCC 4 cut(s) 417, 439, 505, 789
HapII CCGG 1 cut(s) 411
HhaI GCGC 2 cut(s) 321, 360
Hin1II CATG 6 cut(s) 223, 394, 682, 850, 928, 1038
Hin6I GCGC 2 cut(s) 319, 358
HinP1I GCGC 2 cut(s) 319, 358
HinfI GANTC 6 cut(s) 296, 335, 570, 588, 727, 860
HpaII CCGG 1 cut(s) 411
HphI GGTGA 4 cut(s) 291, 330, 371, 855
Hpy166II GTNNAC 1 cut(s) 225
Hpy188I TCNGA 4 cut(s) 114, 490, 575, 1052
Hpy188III TCNNGA 4 cut(s) 715, 731, 847, 925
Hpy8I GTNNAC 1 cut(s) 225
HpyAV CCTTC 5 cut(s) 317, 356, 386, 443, 662
HpyCH4III ACNGT 1 cut(s) 200
HpyCH4V TGCA 6 cut(s) 189, 272, 596, 682, 779, 1046
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 33
HpyF3I CTNAG 6 cut(s) 314, 353, 487, 723, 743, 984
Hsp92II CATG 6 cut(s) 223, 394, 682, 850, 928, 1038
HspAI GCGC 2 cut(s) 319, 358
Kzo9I GATC 1 cut(s) 492
LmnI GCTCC 2 cut(s) 520, 616
Lsp1109I GCAGC 3 cut(s) 580, 608, 676
LweI GCATC 1 cut(s) 176
MaeI CTAG 1 cut(s) 419
MaeIII GTNAC 2 cut(s) 406, 861
MalI GATC 1 cut(s) 494
MboI GATC 1 cut(s) 492
MboII GAAGA 4 cut(s) 8, 487, 685, 766
MflI RGATCY 1 cut(s) 492
MhlI GDGCHC 2 cut(s) 426, 525
MlsI TGGCCA 1 cut(s) 789
MluCI AATT 7 cut(s) 12, 210, 564, 646, 657, 762, 1027
MluNI TGGCCA 1 cut(s) 789
MlyI GAGTC 3 cut(s) 579, 582, 869
MmeI TCCRAC 2 cut(s) 185, 498
Mox20I TGGCCA 1 cut(s) 789
Mph1103I ATGCAT 2 cut(s) 191, 684
MscI TGGCCA 1 cut(s) 789
MseI TTAA 2 cut(s) 150, 642
MslI CAYNNNNRTG 1 cut(s) 683
Msp20I TGGCCA 1 cut(s) 789
MspA1I CMGCKG 1 cut(s) 599
MspI CCGG 1 cut(s) 411
MspR9I CCNGG 5 cut(s) 303, 342, 399, 561, 615
Mva1269I GAATGC 1 cut(s) 1046
MvaI CCWGG 5 cut(s) 303, 342, 399, 561, 615
MvnI CGCG 2 cut(s) 321, 360
MwoI GCNNNNNNNGC 2 cut(s) 28, 33
NdeI CATATG 1 cut(s) 684
NdeII GATC 1 cut(s) 492
NlaIII CATG 6 cut(s) 223, 394, 682, 850, 928, 1038
NlaIV GGNNCC 6 cut(s) 217, 291, 396, 555, 734, 810
NmuCI GTSAC 1 cut(s) 861
NsiI ATGCAT 2 cut(s) 191, 684
NspI RCATGY 1 cut(s) 682
NspV TTCGAA 1 cut(s) 120
PagI TCATGA 2 cut(s) 846, 924
PceI AGGCCT 2 cut(s) 439, 505
PctI GAATGC 1 cut(s) 1046
PfeI GAWTC 3 cut(s) 296, 335, 727
PfoI TCCNGGA 1 cut(s) 559
PinAI ACCGGT 1 cut(s) 410
PkrI GCNGC 4 cut(s) 7, 595, 598, 691
PleI GAGTC 3 cut(s) 578, 582, 868
PpsI GAGTC 3 cut(s) 578, 582, 868
Psp124BI GAGCTC 1 cut(s) 426
Psp6I CCWGG 5 cut(s) 301, 340, 397, 559, 613
PspGI CCWGG 5 cut(s) 301, 340, 397, 559, 613
PspN4I GGNNCC 6 cut(s) 217, 291, 396, 555, 734, 810
PspPI GGNCC 6 cut(s) 216, 394, 553, 733, 890, 935
PstI CTGCAG 1 cut(s) 598
PsuI RGATCY 1 cut(s) 492
PvuII CAGCTG 1 cut(s) 599
RsaI GTAC 2 cut(s) 226, 254
RsaNI GTAC 2 cut(s) 225, 253
RseI CAYNNNNRTG 1 cut(s) 683
SacI GAGCTC 1 cut(s) 426
SaqAI TTAA 2 cut(s) 150, 642
SatI GCNGC 4 cut(s) 6, 594, 597, 690
Sau3AI GATC 1 cut(s) 492
Sau96I GGNCC 6 cut(s) 216, 394, 553, 733, 890, 935
SchI GAGTC 3 cut(s) 579, 582, 869
ScrFI CCNGG 5 cut(s) 303, 342, 399, 561, 615
SduI GDGCHC 2 cut(s) 426, 525
SfaNI GCATC 1 cut(s) 176
SfcI CTRYAG 1 cut(s) 594
SfuI TTCGAA 1 cut(s) 120
SinI GGWCC 6 cut(s) 216, 394, 553, 733, 890, 935
SmiMI CAYNNNNRTG 1 cut(s) 683
Sse9I AATT 7 cut(s) 12, 210, 564, 646, 657, 762, 1027
SseBI AGGCCT 2 cut(s) 439, 505
SspMI CTAG 1 cut(s) 419
SstI GAGCTC 1 cut(s) 426
StuI AGGCCT 2 cut(s) 439, 505
StyD4I CCNGG 5 cut(s) 301, 340, 397, 559, 613
StyI CCWWGG 1 cut(s) 90
TaaI ACNGT 1 cut(s) 200
TaqI TCGA 4 cut(s) 59, 120, 568, 858
TaqII GACCGA 1 cut(s) 923
TasI AATT 7 cut(s) 12, 210, 564, 646, 657, 762, 1027
TatI WGTACW 2 cut(s) 224, 252
TfiI GAWTC 3 cut(s) 296, 335, 727
Tru1I TTAA 2 cut(s) 150, 642
Tru9I TTAA 2 cut(s) 150, 642
TscAI CASTG 2 cut(s) 537, 727
TseFI GTSAC 1 cut(s) 861
TseI GCWGC 4 cut(s) 5, 593, 596, 689
Tsp45I GTSAC 1 cut(s) 861
TspDTI ATGAA 6 cut(s) 141, 555, 681, 835, 863, 941
TspRI CASTG 2 cut(s) 537, 727
VpaK11BI GGWCC 6 cut(s) 216, 394, 553, 733, 890, 935
XagI CCTNNNNNAGG 1 cut(s) 876
XapI RAATTY 2 cut(s) 564, 646
XceI RCATGY 1 cut(s) 682
XspI CTAG 1 cut(s) 419
Zsp2I ATGCAT 2 cut(s) 191, 684
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.