Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003329.1

Orthogroup ID

OG0008109

Physical Location & Seq

Genomic Coordinates Forward (+)

16289 .. 16852

Gene Structure 564 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003329.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 564 bp

atggctgcagttgaaaatttagacattgaaagtggaggccatactagtcaagaagatgcaggcttggagcttctttggagcaagagactcaaaaacaaattcttgaatagtaatttgggggtgtttttgagttccagtgagtcaattatgtgcaaatatggcattcaatcatctaggagtttggaaagatatggccaagttatgattgaaagtgaggtagtaatgaattcagaagaaagtcgagggcatttgaaccttgcagagaaaacatatgagaatgagaggcacaggaataccaactctaggaatgctctgaagccaccgcgacctcctaaaggtccatcactcgatgctgctgatcagaagttggttagggagatcgtggagcttgctaggagaaagcgtgcaagaattcaacaaattaaggcagcaaagaagacgaaagcaaccaagtcatcatctgtgcaaagtggcatatctgccatgatcgtcacactattgttcttctgtgtcataatatttcaaggtagacttttcccttctcttttcatcttttgtatgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

187

Amino Acids

21.02

Weight (kDa)

9.68

Isoelectric Point (pI)

54.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008109)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g26900 FvH4_1g26900 FvH4_1g26900 FvH4_1g26900 FvH4_1g26900
malus_domestica	MD09G1285700.v1.1 MD17G1278300.v1.1
prunus_persica	Prupe.3G008100_v2.0.a1 Prupe.3G008100_v2.0.a1 Prupe.3G008100_v2.0.a1
pyrus_communis	pycom09g19290
rosa_chinensis	RchiOBHm_Chr3g0487151
rosa_laevigata	RLG00000023026
rosa_multiflora	Rmu_sc0003329.1_g000004 Rmu_sc0003843.1_g000007
rosa_roxburghii	Rroxscaffold_6G00395100
rosa_rugosa	Rorug03G0231600 Rorug03G0231600 Rorug03G0231700
rosa_samantha	Rh3AG279700 Rh3BG315800 Rh3CG313900 Rh3DG311100
rosa_wichuraiana	Rw3G024790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	529
AccII	CGCG	1 cut(s)	325
AciI	CCGC	1 cut(s)	323
AcoI	YGGCCR	1 cut(s)	193
AcsI	RAATTY	4 cut(s)	16, 98, 226, 411
AcuI	CTGAAG	1 cut(s)	335
AfiI	CCNNNNNNNGG	2 cut(s)	303, 335
AgsI	TTSAA	8 cut(s)	14, 29, 106, 167, 209, 253, 416, 524
AhlI	ACTAGT	1 cut(s)	44
AjuI	GAANNNNNNNTTGG	2 cut(s)	98, 130
AluBI	AGCT	2 cut(s)	70, 388
AluI	AGCT	2 cut(s)	70, 388
Alw26I	GTCTC	1 cut(s)	79
AoxI	GGCC	2 cut(s)	37, 193
ApeKI	GCWGC	3 cut(s)	5, 353, 428
ApoI	RAATTY	4 cut(s)	16, 98, 226, 411
AspS9I	GGNCC	1 cut(s)	338
AvaII	GGWCC	1 cut(s)	338
BalI	TGGCCA	1 cut(s)	195
BbsI	GAAGAC	1 cut(s)	443
BbvI	GCAGC	2 cut(s)	340, 440
BccI	CCATC	1 cut(s)	349
BclI	TGATCA	1 cut(s)	358
BcoDI	GTCTC	1 cut(s)	79
BcuI	ACTAGT	1 cut(s)	44
BfaI	CTAG	4 cut(s)	45, 174, 303, 393
BfmI	CTRYAG	1 cut(s)	6
BisI	GCNGC	3 cut(s)	6, 354, 429
BlsI	GCNGC	3 cut(s)	7, 355, 430
Bme18I	GGWCC	1 cut(s)	338
BmgT120I	GGNCC	1 cut(s)	338
BmsI	GCATC	2 cut(s)	46, 340
BpiI	GAAGAC	1 cut(s)	443
BsaXI	ACNNNNNCTCC	2 cut(s)	388, 418
Bsc4I	CCNNNNNNNGG	2 cut(s)	303, 335
Bse1I	ACTGG	1 cut(s)	135
BseLI	CCNNNNNNNGG	2 cut(s)	303, 335
BseNI	ACTGG	1 cut(s)	135
BseXI	GCAGC	2 cut(s)	340, 440
Bsh1236I	CGCG	1 cut(s)	325
BshFI	GGCC	2 cut(s)	39, 195
BslI	CCNNNNNNNGG	2 cut(s)	303, 335
BsmAI	GTCTC	1 cut(s)	79
BsmI	GAATGC	2 cut(s)	162, 313
BsnI	GGCC	2 cut(s)	39, 195
Bsp143I	GATC	3 cut(s)	358, 378, 486
BspACI	CCGC	1 cut(s)	323
BspANI	GGCC	2 cut(s)	39, 195
BspFNI	CGCG	1 cut(s)	325
BspMAI	CTGCAG	1 cut(s)	10
BsrI	ACTGG	1 cut(s)	135
BssMI	GATC	3 cut(s)	358, 378, 486
BstC8I	GCNNGC	3 cut(s)	61, 390, 405
BstENI	CCTNNNNNAGG	1 cut(s)	333
BstFNI	CGCG	1 cut(s)	325
BstKTI	GATC	3 cut(s)	361, 381, 489
BstMAI	GTCTC	1 cut(s)	79
BstMBI	GATC	3 cut(s)	358, 378, 486
BstMWI	GCNNNNNNNGC	1 cut(s)	159
BstSFI	CTRYAG	1 cut(s)	6
BstUI	CGCG	1 cut(s)	325
BstV1I	GCAGC	2 cut(s)	340, 440
BstV2I	GAAGAC	1 cut(s)	443
BsuRI	GGCC	2 cut(s)	39, 195
BtsIMutI	CAGTG	1 cut(s)	142
Cac8I	GCNNGC	3 cut(s)	61, 390, 405
Cfr13I	GGNCC	1 cut(s)	338
CviAII	CATG	1 cut(s)	484
CviJI	RGCY	7 cut(s)	5, 39, 63, 70, 195, 319, 388
CviKI_1	RGCY	7 cut(s)	5, 39, 63, 70, 195, 319, 388
DpnI	GATC	3 cut(s)	360, 380, 488
DpnII	GATC	3 cut(s)	358, 378, 486
EaeI	YGGCCR	1 cut(s)	193
Eco47I	GGWCC	1 cut(s)	338
Eco57I	CTGAAG	1 cut(s)	335
EcoNI	CCTNNNNNAGG	1 cut(s)	333
EcoRI	GAATTC	2 cut(s)	226, 411
FaeI	CATG	1 cut(s)	487
FalI	AAGNNNNNCTT	2 cut(s)	516, 548
FatI	CATG	1 cut(s)	483
FauNDI	CATATG	1 cut(s)	271
FbaI	TGATCA	1 cut(s)	358
FblI	GTMKAC	1 cut(s)	529
Fnu4HI	GCNGC	3 cut(s)	6, 354, 429
Fsp4HI	GCNGC	3 cut(s)	6, 354, 429
FspBI	CTAG	4 cut(s)	45, 174, 303, 393
GluI	GCNGC	3 cut(s)	6, 354, 429
HaeIII	GGCC	2 cut(s)	39, 195
Hin1II	CATG	1 cut(s)	487
HinfI	GANTC	2 cut(s)	87, 140
Hpy166II	GTNNAC	1 cut(s)	530
Hpy188I	TCNGA	3 cut(s)	232, 315, 363
Hpy188III	TCNNGA	2 cut(s)	50, 103
Hpy8I	GTNNAC	1 cut(s)	530
HpyAV	CCTTC	1 cut(s)	549
HpyCH4V	TGCA	6 cut(s)	8, 59, 153, 260, 407, 466
HpyF10VI	GCNNNNNNNGC	1 cut(s)	159
Hsp92II	CATG	1 cut(s)	487
Ksp22I	TGATCA	1 cut(s)	358
Kzo9I	GATC	3 cut(s)	358, 378, 486
LmnI	GCTCC	3 cut(s)	67, 78, 385
LpnPI	CCDG	3 cut(s)	45, 148, 274
Lsp1109I	GCAGC	2 cut(s)	340, 440
LweI	GCATC	2 cut(s)	46, 340
MaeI	CTAG	4 cut(s)	45, 174, 303, 393
MaeIII	GTNAC	1 cut(s)	490
MalI	GATC	3 cut(s)	360, 380, 488
MboI	GATC	3 cut(s)	358, 378, 486
MboII	GAAGA	4 cut(s)	65, 245, 448, 496
MlsI	TGGCCA	1 cut(s)	195
MluCI	AATT	7 cut(s)	16, 98, 112, 144, 226, 411, 420
MluNI	TGGCCA	1 cut(s)	195
MlyI	GAGTC	2 cut(s)	81, 149
MnlI	CCTC	5 cut(s)	29, 208, 236, 276, 339
Mox20I	TGGCCA	1 cut(s)	195
MscI	TGGCCA	1 cut(s)	195
MseI	TTAA	1 cut(s)	423
Msp20I	TGGCCA	1 cut(s)	195
Mva1269I	GAATGC	2 cut(s)	162, 313
MvnI	CGCG	1 cut(s)	325
MwoI	GCNNNNNNNGC	1 cut(s)	159
NdeI	CATATG	1 cut(s)	271
NdeII	GATC	3 cut(s)	358, 378, 486
NlaIII	CATG	1 cut(s)	487
NmuCI	GTSAC	1 cut(s)	490
PctI	GAATGC	2 cut(s)	162, 313
PkrI	GCNGC	3 cut(s)	7, 355, 430
PleI	GAGTC	2 cut(s)	81, 148
PpsI	GAGTC	2 cut(s)	81, 148
PspPI	GGNCC	1 cut(s)	338
PstI	CTGCAG	1 cut(s)	10
SaqAI	TTAA	1 cut(s)	423
SatI	GCNGC	3 cut(s)	6, 354, 429
Sau3AI	GATC	3 cut(s)	358, 378, 486
Sau96I	GGNCC	1 cut(s)	338
SchI	GAGTC	2 cut(s)	81, 149
SetI	ASST	7 cut(s)	72, 219, 258, 331, 340, 390, 529
SfaNI	GCATC	2 cut(s)	46, 340
SfcI	CTRYAG	1 cut(s)	6
SinI	GGWCC	1 cut(s)	338
SpeI	ACTAGT	1 cut(s)	44
Sse9I	AATT	7 cut(s)	16, 98, 112, 144, 226, 411, 420
SsiI	CCGC	1 cut(s)	323
SspI	AATATT	1 cut(s)	519
SspMI	CTAG	4 cut(s)	45, 174, 303, 393
TaqI	TCGA	2 cut(s)	241, 348
TasI	AATT	7 cut(s)	16, 98, 112, 144, 226, 411, 420
Tru1I	TTAA	1 cut(s)	423
Tru9I	TTAA	1 cut(s)	423
TscAI	CASTG	1 cut(s)	142
TseFI	GTSAC	1 cut(s)	490
TseI	GCWGC	3 cut(s)	5, 353, 428
Tsp45I	GTSAC	1 cut(s)	490
TspDTI	ATGAA	2 cut(s)	239, 538
TspRI	CASTG	1 cut(s)	142
VpaK11BI	GGWCC	1 cut(s)	338
XagI	CCTNNNNNAGG	1 cut(s)	333
XapI	RAATTY	4 cut(s)	16, 98, 226, 411
XmiI	GTMKAC	1 cut(s)	529
XspI	CTAG	4 cut(s)	45, 174, 303, 393

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.