Rmu_sc0003429.1_g000015

Hydrophobic seed protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003429.1
OG0016484
Physical Location & Seq
Forward (+)
77665 .. 78192
528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003429.1_g000015.1.cds

Sequence Viewer

Length: 528 bp
atggcttccagaagcactgcctcacttgctctcttcctggcactgaatctcctcttcttcaccatggttgctaatgcctgcaacacatgccctcagccgaagccgaggccgaatcccagaccgaatccaaggccgaatcccaatcccaatcccaatcccaatcccaatcccaatccgaatccgaatccgaatccgaatccgaatccgaatccgaatccaaatccgaatccgaatccgaatccgaatccaaaccccaccccatccaggggtacttgccctagggataccctaaaattgggggtttgtgctaatgtcctcaacgggttgcttaacctcaccattggcaatcctccagttcaaccttgctgcactctcatccaaggccttgctgaccttgaagctgctgtatgcctctgcactgccatcagagccaacattctgggcatcaacctcaacattccggtttctctcagcttgcttcttaatgtctgtggaaaccgggtcccaagagggttccaatgtgcctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Hydrophob_seed

Protein Analysis

175

Amino Acids

18.49

Weight (kDa)

9.3

Isoelectric Point (pI)

29.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016484)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G12090 AT1G62510
fragaria_vesca FvH4_5g18321
malus_domestica MD04G1087300.v1.1 MD06G1062000.v1.1
prunus_persica Prupe.5G073200_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0202791
rosa_laevigata RLG00000003571
rosa_multiflora Rmu_sc0002590.1_g000022 Rmu_sc0003429.1_g000015
rosa_roxburghii Rroxscaffold_3G00254260
rosa_rugosa Rorug07G0073200
rosa_samantha Rh7AG200900
rosa_wichuraiana Rw7G017570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 271
AfiI CCNNNNNNNGG 4 cut(s) 264, 265, 266, 295
AgsI TTSAA 2 cut(s) 359, 398
AjnI CCWGG 2 cut(s) 36, 263
AluBI AGCT 2 cut(s) 401, 474
AluI AGCT 2 cut(s) 401, 474
AoxI GGCC 3 cut(s) 107, 131, 382
ApeKI GCWGC 2 cut(s) 366, 401
AspA2I CCTAGG 1 cut(s) 278
AspS9I GGNCC 1 cut(s) 502
AsuC2I CCSGG 1 cut(s) 500
AsuHPI GGTGA 2 cut(s) 52, 328
AvaII GGWCC 1 cut(s) 502
AvrII CCTAGG 1 cut(s) 278
BbvCI CCTCAGC 1 cut(s) 93
BbvI GCAGC 2 cut(s) 353, 388
BccI CCATC 2 cut(s) 268, 431
BciT130I CCWGG 2 cut(s) 38, 265
BciVI GTATCC 1 cut(s) 277
BcnI CCSGG 1 cut(s) 500
BfaI CTAG 2 cut(s) 279, 526
BfuI GTATCC 1 cut(s) 277
BisI GCNGC 2 cut(s) 367, 402
BlnI CCTAGG 1 cut(s) 278
BlsI GCNGC 2 cut(s) 368, 403
Bme1390I CCNGG 3 cut(s) 38, 265, 500
Bme18I GGWCC 1 cut(s) 502
BmgT120I GGNCC 1 cut(s) 502
BmiI GGNNCC 3 cut(s) 503, 504, 515
BmrFI CCNGG 3 cut(s) 38, 265, 500
BmsI GCATC 1 cut(s) 453
BpmI CTGGAG 1 cut(s) 336
Bpu10I CCTNAGC 1 cut(s) 93
BpuMI CCSGG 1 cut(s) 500
BsaJI CCNNGG 6 cut(s) 63, 104, 128, 264, 278, 379
BsaWI WCCGGW 1 cut(s) 460
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
Bsc4I CCNNNNNNNGG 4 cut(s) 264, 265, 266, 295
Bse1I ACTGG 1 cut(s) 353
BseBI CCWGG 2 cut(s) 38, 265
BseDI CCNNGG 6 cut(s) 63, 104, 128, 264, 278, 379
BseGI GGATG 2 cut(s) 260, 375
BseLI CCNNNNNNNGG 4 cut(s) 264, 265, 266, 295
BseMII CTCAG 2 cut(s) 107, 484
BseNI ACTGG 1 cut(s) 353
BseRI GAGGAG 1 cut(s) 41
BseXI GCAGC 2 cut(s) 353, 388
BsgI GTGCAG 2 cut(s) 352, 400
BshFI GGCC 3 cut(s) 109, 133, 384
BsiSI CCGG 2 cut(s) 461, 499
BslFI GGGAC 1 cut(s) 488
BslI CCNNNNNNNGG 4 cut(s) 264, 265, 266, 295
BsmFI GGGAC 1 cut(s) 488
BsnI GGCC 3 cut(s) 109, 133, 384
Bsp19I CCATGG 1 cut(s) 63
BspANI GGCC 3 cut(s) 109, 133, 384
BspCNI CTCAG 2 cut(s) 106, 483
BspLI GGNNCC 3 cut(s) 503, 504, 515
BsrI ACTGG 1 cut(s) 353
BssECI CCNNGG 6 cut(s) 63, 104, 128, 264, 278, 379
BssT1I CCWWGG 4 cut(s) 63, 128, 278, 379
Bst2UI CCWGG 2 cut(s) 38, 265
Bst6I CTCTTC 2 cut(s) 38, 59
BstAPI GCANNNNNTGC 1 cut(s) 87
BstC8I GCNNGC 2 cut(s) 79, 476
BstDEI CTNAG 2 cut(s) 93, 470
BstDSI CCRYGG 1 cut(s) 63
BstF5I GGATG 2 cut(s) 260, 375
BstMWI GCNNNNNNNGC 3 cut(s) 26, 87, 428
BstNI CCWGG 2 cut(s) 38, 265
BstNSI RCATGY 1 cut(s) 90
BstSCI CCNGG 3 cut(s) 36, 263, 498
BstV1I GCAGC 2 cut(s) 353, 388
BstXI CCANNNNNNTGG 1 cut(s) 439
BsuI GTATCC 1 cut(s) 277
BsuRI GGCC 3 cut(s) 109, 133, 384
BtgI CCRYGG 1 cut(s) 63
BtsCI GGATG 2 cut(s) 260, 375
BtsI GCAGTG 2 cut(s) 15, 417
BtsIMutI CAGTG 3 cut(s) 15, 41, 417
Cac8I GCNNGC 2 cut(s) 79, 476
Cfr13I GGNCC 1 cut(s) 502
Csp6I GTAC 1 cut(s) 270
CviAII CATG 2 cut(s) 64, 87
CviJI RGCY 9 cut(s) 5, 97, 103, 109, 133, 384, 401, 431, 474
CviKI_1 RGCY 9 cut(s) 5, 97, 103, 109, 133, 384, 401, 431, 474
CviQI GTAC 1 cut(s) 270
DdeI CTNAG 2 cut(s) 93, 470
Eam1104I CTCTTC 2 cut(s) 38, 59
EarI CTCTTC 2 cut(s) 38, 59
Eco130I CCWWGG 4 cut(s) 63, 128, 278, 379
Eco147I AGGCCT 1 cut(s) 384
Eco47I GGWCC 1 cut(s) 502
EcoO109I RGGNCCY 1 cut(s) 502
EcoRII CCWGG 2 cut(s) 36, 263
EcoT14I CCWWGG 4 cut(s) 63, 128, 278, 379
ErhI CCWWGG 4 cut(s) 63, 128, 278, 379
FaeI CATG 2 cut(s) 67, 90
FaiI YATR 3 cut(s) 65, 88, 409
FaqI GGGAC 1 cut(s) 488
FatI CATG 2 cut(s) 63, 86
Fnu4HI GCNGC 2 cut(s) 367, 402
FokI GGATG 2 cut(s) 247, 362
Fsp4HI GCNGC 2 cut(s) 367, 402
FspBI CTAG 2 cut(s) 279, 526
GluI GCNGC 2 cut(s) 367, 402
GsuI CTGGAG 1 cut(s) 336
HaeIII GGCC 3 cut(s) 109, 133, 384
HapII CCGG 2 cut(s) 461, 499
Hin1II CATG 2 cut(s) 67, 90
HpaII CCGG 2 cut(s) 461, 499
HphI GGTGA 2 cut(s) 52, 328
Hpy188III TCNNGA 1 cut(s) 9
HpyCH4V TGCA 3 cut(s) 81, 369, 417
HpyF10VI GCNNNNNNNGC 3 cut(s) 26, 87, 428
HpyF3I CTNAG 2 cut(s) 93, 470
Hsp92II CATG 2 cut(s) 67, 90
KflI GGGWCCC 1 cut(s) 502
Lsp1109I GCAGC 2 cut(s) 353, 388
LweI GCATC 1 cut(s) 453
MaeI CTAG 2 cut(s) 279, 526
MboII GAAGA 3 cut(s) 25, 46, 49
MluCI AATT 1 cut(s) 293
MseI TTAA 2 cut(s) 330, 483
MspI CCGG 2 cut(s) 461, 499
MspR9I CCNGG 3 cut(s) 38, 265, 500
MvaI CCWGG 2 cut(s) 38, 265
MwoI GCNNNNNNNGC 3 cut(s) 26, 87, 428
NciI CCSGG 1 cut(s) 500
NcoI CCATGG 1 cut(s) 63
NlaIII CATG 2 cut(s) 67, 90
NlaIV GGNNCC 3 cut(s) 503, 504, 515
NmeAIII GCCGAG 1 cut(s) 129
NspI RCATGY 1 cut(s) 90
PceI AGGCCT 1 cut(s) 384
PkrI GCNGC 2 cut(s) 368, 403
PpuMI RGGWCCY 1 cut(s) 502
Psp5II RGGWCCY 1 cut(s) 502
Psp6I CCWGG 2 cut(s) 36, 263
PspGI CCWGG 2 cut(s) 36, 263
PspN4I GGNNCC 3 cut(s) 503, 504, 515
PspPI GGNCC 1 cut(s) 502
PspPPI RGGWCCY 1 cut(s) 502
RsaI GTAC 1 cut(s) 271
RsaNI GTAC 1 cut(s) 270
SaqAI TTAA 2 cut(s) 330, 483
SatI GCNGC 2 cut(s) 367, 402
Sau96I GGNCC 1 cut(s) 502
ScrFI CCNGG 3 cut(s) 38, 265, 500
SetI ASST 6 cut(s) 336, 364, 396, 403, 453, 476
SfaNI GCATC 1 cut(s) 453
SinI GGWCC 1 cut(s) 502
Sse9I AATT 1 cut(s) 293
SseBI AGGCCT 1 cut(s) 384
SspMI CTAG 2 cut(s) 279, 526
StuI AGGCCT 1 cut(s) 384
StyD4I CCNGG 3 cut(s) 36, 263, 498
StyI CCWWGG 4 cut(s) 63, 128, 278, 379
TaqII GACCGA 1 cut(s) 136
TasI AATT 1 cut(s) 293
Tru1I TTAA 2 cut(s) 330, 483
Tru9I TTAA 2 cut(s) 330, 483
TscAI CASTG 3 cut(s) 22, 48, 424
TseI GCWGC 2 cut(s) 366, 401
TspRI CASTG 3 cut(s) 22, 48, 424
VpaK11BI GGWCC 1 cut(s) 502
XceI RCATGY 1 cut(s) 90
XmaJI CCTAGG 1 cut(s) 278
XspI CTAG 2 cut(s) 279, 526
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.