Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003687.1

Orthogroup ID

OG0008907

Physical Location & Seq

Genomic Coordinates Forward (+)

25603 .. 26491

Gene Structure 889 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003687.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 600 bp

atgtccgacgaagaaatcctgaacttcatcaatggaaagtattctccggggtacagcactgcctttgatgttggtgatcttttcacgatcactaagaccatcattgatcatgcaacccgtaattcgatggtcgatgatattctgaagtcggccaatgccctgaatgagaaggtccccaacatcaacgacagcttcatctcgccattgtgcactcttaagtccatttgctgcgagatgtcatcatgtatggataaggcttgttctggtcaagaaatttccatccaaccaaggacggaagtgatatttgacaagctaaaaccctatccatgggacgctaaggcagtgctggccctagcggcttttgctttggaatacggagacttctggcacctcgcccagctctatggccaatgtaaccaactcaccaattcactggctatcctgaccaagcatgcgaccttggagaaacgcaaggaggaagtacttgagctgaaccatctcatcaaggctactttgcaagtgactgatttcatctttaaggttgaggatctttttgttcacaatcataacgagaatgtaaaagagttgacaaggcagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SEO_C SEO_N

Protein Analysis

199

Amino Acids

22.49

Weight (kDa)

5.22

Isoelectric Point (pI)

40.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008907)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0389961 RchiOBHm_Chr4g0400271 RchiOBHm_Chr4g0400571
rosa_laevigata	RLG00000009943
rosa_multiflora	Rmu_sc0003687.1_g000008 Rmu_sc0004336.1_g000023 Rmu_sc0005451.1_g000008 Rmu_ssc0000245.1_g000002
rosa_roxburghii	Rroxscaffold_5G00336110 Rroxscaffold_5G00345410
rosa_rugosa	Rorug03G0327600 Rorug04G0024500
rosa_samantha	Rh4AG030800 Rh4AG102000 Rh4BG024200 Rh4BG097700 Rh4CG033300 Rh4CG110100 Rh4DG024300
rosa_wichuraiana	Rw4G002340 Rw4G002380 Rw4G008280 Rw4G008290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	387
AciI	CCGC	1 cut(s)	356
AclWI	GGATC	1 cut(s)	555
AcoI	YGGCCR	2 cut(s)	150, 406
AcsI	RAATTY	1 cut(s)	273
AcuI	CTGAAG	1 cut(s)	164
AfaI	GTAC	2 cut(s)	53, 483
AfiI	CCNNNNNNNGG	1 cut(s)	327
AflII	CTTAAG	1 cut(s)	215
AluBI	AGCT	4 cut(s)	192, 313, 400, 490
AluI	AGCT	4 cut(s)	192, 313, 400, 490
Alw21I	GWGCWC	1 cut(s)	212
Alw26I	GTCTC	1 cut(s)	372
Alw44I	GTGCAC	1 cut(s)	208
AlwI	GGATC	1 cut(s)	555
AoxI	GGCC	3 cut(s)	150, 348, 406
ApaLI	GTGCAC	1 cut(s)	208
ApeKI	GCWGC	1 cut(s)	228
ApoI	RAATTY	1 cut(s)	273
Asp700I	GAANNNNTTC	1 cut(s)	40
AspS9I	GGNCC	2 cut(s)	172, 349
AsuC2I	CCSGG	1 cut(s)	48
AsuHPI	GGTGA	2 cut(s)	86, 415
AvaII	GGWCC	1 cut(s)	172
BaeGI	GKGCMC	1 cut(s)	212
BalI	TGGCCA	1 cut(s)	408
BanI	GGYRCC	1 cut(s)	387
Bbv12I	GWGCWC	1 cut(s)	212
BbvI	GCAGC	1 cut(s)	215
BccI	CCATC	4 cut(s)	107, 121, 287, 504
BclI	TGATCA	1 cut(s)	106
BcnI	CCSGG	1 cut(s)	48
BcoDI	GTCTC	1 cut(s)	372
BfaI	CTAG	1 cut(s)	353
BfrI	CTTAAG	1 cut(s)	215
BglI	GCCNNNNNGGC	1 cut(s)	356
BisI	GCNGC	2 cut(s)	229, 357
BlsI	GCNGC	2 cut(s)	230, 358
BmcAI	AGTACT	1 cut(s)	483
Bme1390I	CCNGG	1 cut(s)	48
Bme18I	GGWCC	1 cut(s)	172
BmgT120I	GGNCC	2 cut(s)	172, 349
BmiI	GGNNCC	2 cut(s)	174, 389
BmrFI	CCNGG	1 cut(s)	48
Bpu10I	CCTNAGC	1 cut(s)	336
BpuEI	CTTGAG	1 cut(s)	506
BpuMI	CCSGG	1 cut(s)	48
BsaJI	CCNNGG	4 cut(s)	47, 287, 326, 459
Bsc4I	CCNNNNNNNGG	1 cut(s)	327
Bse1I	ACTGG	1 cut(s)	438
BseDI	CCNNGG	4 cut(s)	47, 287, 326, 459
BseGI	GGATG	1 cut(s)	279
BseLI	CCNNNNNNNGG	1 cut(s)	327
BseNI	ACTGG	1 cut(s)	438
BseSI	GKGCMC	1 cut(s)	212
BseXI	GCAGC	1 cut(s)	215
BseYI	CCCAGC	1 cut(s)	396
BshFI	GGCC	3 cut(s)	152, 350, 408
BshNI	GGYRCC	1 cut(s)	387
BsiHKAI	GWGCWC	1 cut(s)	212
BsiSI	CCGG	1 cut(s)	47
BslFI	GGGAC	2 cut(s)	158, 344
BslI	CCNNNNNNNGG	1 cut(s)	327
BsmAI	GTCTC	1 cut(s)	372
BsmFI	GGGAC	2 cut(s)	158, 344
BsnI	GGCC	3 cut(s)	152, 350, 408
Bsp1286I	GDGCHC	1 cut(s)	212
Bsp143I	GATC	4 cut(s)	76, 87, 106, 547
Bsp19I	CCATGG	1 cut(s)	326
BspACI	CCGC	1 cut(s)	356
BspANI	GGCC	3 cut(s)	152, 350, 408
BspLI	GGNNCC	2 cut(s)	174, 389
BspPI	GGATC	1 cut(s)	555
BspT107I	GGYRCC	1 cut(s)	387
BspTI	CTTAAG	1 cut(s)	215
BsrI	ACTGG	1 cut(s)	438
BssECI	CCNNGG	4 cut(s)	47, 287, 326, 459
BssMI	GATC	4 cut(s)	76, 87, 106, 547
BssT1I	CCWWGG	3 cut(s)	287, 326, 459
BstAFI	CTTAAG	1 cut(s)	215
BstC8I	GCNNGC	2 cut(s)	348, 453
BstDEI	CTNAG	2 cut(s)	93, 336
BstDSI	CCRYGG	1 cut(s)	326
BstF5I	GGATG	1 cut(s)	279
BstKTI	GATC	4 cut(s)	79, 90, 109, 550
BstMAI	GTCTC	1 cut(s)	372
BstMBI	GATC	4 cut(s)	76, 87, 106, 547
BstMWI	GCNNNNNNNGC	3 cut(s)	347, 356, 362
BstNSI	RCATGY	1 cut(s)	455
BstSCI	CCNGG	1 cut(s)	46
BstSLI	GKGCMC	1 cut(s)	212
BstV1I	GCAGC	1 cut(s)	215
BstX2I	RGATCY	1 cut(s)	547
BstXI	CCANNNNNNTGG	2 cut(s)	404, 433
BstYI	RGATCY	1 cut(s)	547
BsuRI	GGCC	3 cut(s)	152, 350, 408
BtgI	CCRYGG	1 cut(s)	326
BtsCI	GGATG	1 cut(s)	279
BtsI	GCAGTG	2 cut(s)	57, 348
BtsIMutI	CAGTG	3 cut(s)	57, 348, 431
Cac8I	GCNNGC	2 cut(s)	348, 453
Cfr13I	GGNCC	2 cut(s)	172, 349
CseI	GACGC	1 cut(s)	341
Csp6I	GTAC	2 cut(s)	52, 482
CviAII	CATG	4 cut(s)	110, 243, 327, 452
CviQI	GTAC	2 cut(s)	52, 482
DdeI	CTNAG	2 cut(s)	93, 336
DpnI	GATC	4 cut(s)	78, 89, 108, 549
DpnII	GATC	4 cut(s)	76, 87, 106, 547
EaeI	YGGCCR	2 cut(s)	150, 406
Eco130I	CCWWGG	3 cut(s)	287, 326, 459
Eco47I	GGWCC	1 cut(s)	172
Eco57I	CTGAAG	1 cut(s)	164
EcoO109I	RGGNCCY	1 cut(s)	172
EcoT14I	CCWWGG	3 cut(s)	287, 326, 459
ErhI	CCWWGG	3 cut(s)	287, 326, 459
FaeI	CATG	4 cut(s)	113, 246, 330, 455
FaiI	YATR	7 cut(s)	111, 244, 248, 328, 405, 453, 567
FaqI	GGGAC	2 cut(s)	158, 344
FatI	CATG	4 cut(s)	109, 242, 326, 451
FbaI	TGATCA	1 cut(s)	106
Fnu4HI	GCNGC	2 cut(s)	229, 357
FokI	GGATG	1 cut(s)	266
Fsp4HI	GCNGC	2 cut(s)	229, 357
FspBI	CTAG	1 cut(s)	353
GluI	GCNGC	2 cut(s)	229, 357
GsaI	CCCAGC	1 cut(s)	400
HaeIII	GGCC	3 cut(s)	152, 350, 408
HapII	CCGG	1 cut(s)	47
HgaI	GACGC	1 cut(s)	341
Hin1II	CATG	4 cut(s)	113, 246, 330, 455
HincII	GTYRAC	1 cut(s)	588
HindII	GTYRAC	1 cut(s)	588
HpaII	CCGG	1 cut(s)	47
HphI	GGTGA	2 cut(s)	86, 415
Hpy166II	GTNNAC	3 cut(s)	210, 559, 588
Hpy188I	TCNGA	2 cut(s)	7, 144
Hpy188III	TCNNGA	4 cut(s)	19, 85, 269, 442
Hpy8I	GTNNAC	3 cut(s)	210, 559, 588
Hpy99I	CGWCG	1 cut(s)	11
HpyAV	CCTTC	1 cut(s)	163
HpyCH4V	TGCA	3 cut(s)	113, 210, 517
HpyF10VI	GCNNNNNNNGC	3 cut(s)	347, 356, 362
HpyF3I	CTNAG	2 cut(s)	93, 336
Hsp92II	CATG	4 cut(s)	113, 246, 330, 455
Ksp22I	TGATCA	1 cut(s)	106
Kzo9I	GATC	4 cut(s)	76, 87, 106, 547
LpnPI	CCDG	9 cut(s)	32, 60, 173, 249, 332, 370, 410, 419, 455
Lsp1109I	GCAGC	1 cut(s)	215
MaeI	CTAG	1 cut(s)	353
MaeIII	GTNAC	2 cut(s)	413, 520
MalI	GATC	4 cut(s)	78, 89, 108, 549
MboI	GATC	4 cut(s)	76, 87, 106, 547
MboII	GAAGA	1 cut(s)	23
MflI	RGATCY	1 cut(s)	547
MhlI	GDGCHC	1 cut(s)	212
MlsI	TGGCCA	1 cut(s)	408
MluCI	AATT	3 cut(s)	121, 273, 427
MluNI	TGGCCA	1 cut(s)	408
MmeI	TCCRAC	2 cut(s)	30, 307
MnlI	CCTC	3 cut(s)	401, 469, 538
Mox20I	TGGCCA	1 cut(s)	408
MroXI	GAANNNNTTC	1 cut(s)	40
MscI	TGGCCA	1 cut(s)	408
MseI	TTAA	2 cut(s)	216, 537
Msp20I	TGGCCA	1 cut(s)	408
MspCI	CTTAAG	1 cut(s)	215
MspI	CCGG	1 cut(s)	47
MspR9I	CCNGG	1 cut(s)	48
MwoI	GCNNNNNNNGC	3 cut(s)	347, 356, 362
NciI	CCSGG	1 cut(s)	48
NcoI	CCATGG	1 cut(s)	326
NdeII	GATC	4 cut(s)	76, 87, 106, 547
NlaIII	CATG	4 cut(s)	113, 246, 330, 455
NlaIV	GGNNCC	2 cut(s)	174, 389
NmuCI	GTSAC	1 cut(s)	520
NspI	RCATGY	1 cut(s)	455
PaeI	GCATGC	1 cut(s)	455
PdmI	GAANNNNTTC	1 cut(s)	40
PkrI	GCNGC	2 cut(s)	230, 358
PpuMI	RGGWCCY	1 cut(s)	172
Psp5II	RGGWCCY	1 cut(s)	172
PspFI	CCCAGC	1 cut(s)	396
PspN4I	GGNNCC	2 cut(s)	174, 389
PspPI	GGNCC	2 cut(s)	172, 349
PspPPI	RGGWCCY	1 cut(s)	172
PsuI	RGATCY	1 cut(s)	547
RsaI	GTAC	2 cut(s)	53, 483
RsaNI	GTAC	2 cut(s)	52, 482
SaqAI	TTAA	2 cut(s)	216, 537
SatI	GCNGC	2 cut(s)	229, 357
Sau3AI	GATC	4 cut(s)	76, 87, 106, 547
Sau96I	GGNCC	2 cut(s)	172, 349
ScaI	AGTACT	1 cut(s)	483
ScrFI	CCNGG	1 cut(s)	48
SduI	GDGCHC	1 cut(s)	212
SetI	ASST	8 cut(s)	174, 194, 315, 393, 402, 461, 492, 543
SinI	GGWCC	1 cut(s)	172
SmlI	CTYRAG	2 cut(s)	215, 485
SmoI	CTYRAG	2 cut(s)	215, 485
SphI	GCATGC	1 cut(s)	455
Sse9I	AATT	3 cut(s)	121, 273, 427
SsiI	CCGC	1 cut(s)	356
SspMI	CTAG	1 cut(s)	353
StyD4I	CCNGG	1 cut(s)	46
StyI	CCWWGG	3 cut(s)	287, 326, 459
TaqI	TCGA	2 cut(s)	125, 132
TasI	AATT	3 cut(s)	121, 273, 427
TatI	WGTACW	1 cut(s)	481
TauI	GCSGC	1 cut(s)	359
Tru1I	TTAA	2 cut(s)	216, 537
Tru9I	TTAA	2 cut(s)	216, 537
TscAI	CASTG	3 cut(s)	64, 348, 438
TseFI	GTSAC	1 cut(s)	520
TseI	GCWGC	1 cut(s)	228
Tsp45I	GTSAC	1 cut(s)	520
TspDTI	ATGAA	3 cut(s)	16, 184, 520
TspGWI	ACGGA	2 cut(s)	308, 390
TspRI	CASTG	3 cut(s)	64, 348, 438
Vha464I	CTTAAG	1 cut(s)	215
VneI	GTGCAC	1 cut(s)	208
VpaK11BI	GGWCC	1 cut(s)	172
XapI	RAATTY	1 cut(s)	273
XceI	RCATGY	1 cut(s)	455
XmnI	GAANNNNTTC	1 cut(s)	40
XspI	CTAG	1 cut(s)	353
ZrmI	AGTACT	1 cut(s)	483

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.