Rmu_sc0004339.1_g000001

Methyladenine glycosylase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004339.1
OG0007725
Physical Location & Seq
Forward (+)
2173 .. 2592
420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004339.1_g000001.1.cds

Sequence Viewer

Length: 420 bp
atgtctaaagcaaatgtaagaagacaattagtacttctggagaagaacaaggttcccaaggagaagagtactactagtgctttcagctcccacttttcttataaacacctaaagagaatctacccaattgggcttcacaagagttcttcatcttcctctctatctctatcatccttatccttgtctttgtcagaaaactccattgactcttcttctatcattgattctacttctccactcgatcagaagatttcatcagcactccgcctcattgcaccgcctccccaaagaagagagtctccggtgcctaaagttgtccaacagcagaatcagagcttccaggatactgataatggggagttgaggaggtgcaattggataacaaagaacagcggtaagttatatatgaaagtactgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03410 map03410
Pfam Domains
Protein Families
Adenine_glyco

Protein Analysis

139

Amino Acids

15.55

Weight (kDa)

10.11

Isoelectric Point (pI)

73.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 102
AccB1I GGYRCC 1 cut(s) 304
AciI CCGC 3 cut(s) 265, 278, 393
AfaI GTAC 3 cut(s) 33, 70, 414
AhlI ACTAGT 1 cut(s) 74
AjnI CCWGG 1 cut(s) 339
AluBI AGCT 2 cut(s) 87, 336
AluI AGCT 2 cut(s) 87, 336
Alw26I GTCTC 1 cut(s) 303
BanI GGYRCC 1 cut(s) 304
BbsI GAAGAC 1 cut(s) 28
BciT130I CCWGG 1 cut(s) 341
BciVI GTATCC 1 cut(s) 337
BcoDI GTCTC 1 cut(s) 303
BcuI ACTAGT 1 cut(s) 74
BfaI CTAG 1 cut(s) 75
BfmI CTRYAG 1 cut(s) 416
BfuI GTATCC 1 cut(s) 337
BmcAI AGTACT 3 cut(s) 33, 70, 414
Bme1390I CCNGG 1 cut(s) 341
BmiI GGNNCC 2 cut(s) 54, 306
BmrFI CCNGG 1 cut(s) 341
BpiI GAAGAC 1 cut(s) 28
BpmI CTGGAG 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 57
BsaWI WCCGGW 1 cut(s) 301
Bse3DI GCAATG 1 cut(s) 270
BseBI CCWGG 1 cut(s) 341
BseDI CCNNGG 1 cut(s) 57
BseGI GGATG 1 cut(s) 170
BseMI GCAATG 1 cut(s) 270
BseRI GAGGAG 1 cut(s) 379
BshNI GGYRCC 1 cut(s) 304
BsiSI CCGG 1 cut(s) 302
BsmAI GTCTC 1 cut(s) 303
Bsp143I GATC 1 cut(s) 241
BspACI CCGC 3 cut(s) 265, 278, 393
BspLI GGNNCC 2 cut(s) 54, 306
BspT107I GGYRCC 1 cut(s) 304
BsrDI GCAATG 1 cut(s) 270
BssECI CCNNGG 1 cut(s) 57
BssMI GATC 1 cut(s) 241
BssT1I CCWWGG 1 cut(s) 57
Bst2UI CCWGG 1 cut(s) 341
Bst4CI ACNGT 1 cut(s) 417
Bst6I CTCTTC 3 cut(s) 59, 214, 286
BstF5I GGATG 1 cut(s) 170
BstKTI GATC 1 cut(s) 244
BstMAI GTCTC 1 cut(s) 303
BstMBI GATC 1 cut(s) 241
BstNI CCWGG 1 cut(s) 341
BstSCI CCNGG 1 cut(s) 339
BstSFI CTRYAG 1 cut(s) 416
BstV2I GAAGAC 1 cut(s) 28
BsuI GTATCC 1 cut(s) 337
BtsCI GGATG 1 cut(s) 170
Csp6I GTAC 3 cut(s) 32, 69, 413
CviJI RGCY 3 cut(s) 87, 133, 336
CviKI_1 RGCY 3 cut(s) 87, 133, 336
CviQI GTAC 3 cut(s) 32, 69, 413
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
Eam1104I CTCTTC 3 cut(s) 59, 214, 286
EarI CTCTTC 3 cut(s) 59, 214, 286
EciI GGCGGA 1 cut(s) 254
Eco130I CCWWGG 1 cut(s) 57
EcoRII CCWGG 1 cut(s) 339
EcoT14I CCWWGG 1 cut(s) 57
ErhI CCWWGG 1 cut(s) 57
FaiI YATR 4 cut(s) 102, 403, 405, 407
FokI GGATG 1 cut(s) 157
FspBI CTAG 1 cut(s) 75
GsuI CTGGAG 1 cut(s) 59
HapII CCGG 1 cut(s) 302
HinfI GANTC 5 cut(s) 117, 206, 224, 296, 328
HpaII CCGG 1 cut(s) 302
Hpy188I TCNGA 3 cut(s) 193, 246, 333
Hpy188III TCNNGA 1 cut(s) 38
HpyCH4III ACNGT 1 cut(s) 417
HpyCH4V TGCA 2 cut(s) 275, 372
Kzo9I GATC 1 cut(s) 241
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 4 cut(s) 23, 315, 326, 353
MaeI CTAG 1 cut(s) 75
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 9 cut(s) 33, 55, 76, 138, 144, 201, 204, 259, 303
MfeI CAATTG 2 cut(s) 126, 373
MluCI AATT 3 cut(s) 26, 126, 373
MlyI GAGTC 2 cut(s) 200, 305
MmeI TCCRAC 1 cut(s) 343
MnlI CCTC 5 cut(s) 166, 278, 291, 357, 360
MspA1I CMGCKG 1 cut(s) 393
MspI CCGG 1 cut(s) 302
MspR9I CCNGG 1 cut(s) 341
MunI CAATTG 2 cut(s) 126, 373
MvaI CCWGG 1 cut(s) 341
NdeII GATC 1 cut(s) 241
NlaIV GGNNCC 2 cut(s) 54, 306
PfeI GAWTC 3 cut(s) 117, 224, 328
PfoI TCCNGGA 1 cut(s) 339
PleI GAGTC 2 cut(s) 200, 304
PpsI GAGTC 2 cut(s) 200, 304
PsiI TTATAA 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 339
PspGI CCWGG 1 cut(s) 339
PspN4I GGNNCC 2 cut(s) 54, 306
RsaI GTAC 3 cut(s) 33, 70, 414
RsaNI GTAC 3 cut(s) 32, 69, 413
Sau3AI GATC 1 cut(s) 241
ScaI AGTACT 3 cut(s) 33, 70, 414
SchI GAGTC 2 cut(s) 200, 305
ScrFI CCNGG 1 cut(s) 341
SetI ASST 5 cut(s) 54, 89, 111, 338, 371
SfcI CTRYAG 1 cut(s) 416
SpeI ACTAGT 1 cut(s) 74
Sse9I AATT 3 cut(s) 26, 126, 373
SsiI CCGC 3 cut(s) 265, 278, 393
SspMI CTAG 1 cut(s) 75
StyD4I CCNGG 1 cut(s) 339
StyI CCWWGG 1 cut(s) 57
TaaI ACNGT 1 cut(s) 417
TaqI TCGA 1 cut(s) 240
TasI AATT 3 cut(s) 26, 126, 373
TatI WGTACW 3 cut(s) 31, 68, 412
TfiI GAWTC 3 cut(s) 117, 224, 328
TspDTI ATGAA 2 cut(s) 138, 243
XspI CTAG 1 cut(s) 75
ZrmI AGTACT 3 cut(s) 33, 70, 414
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.