Rmu_sc0004416.1_g000001

Calcineurin-like phosphoesterase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004416.1
Physical Location & Seq
Reverse (-)
2 .. 3679
3678 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004416.1_g000001.1.cds

Sequence Viewer

Length: 634 bp
atgcagccagatttggttctttttacaggtgattttggtgaagagaacattggaattgttcgcagcgttgcaaatcttgaatttgctaaagcagttattttgggaaaccatgatgcctggcatacaaaaaagttttcaggaaagacaaaagacggcgttcaacttcagctagactgtctaggcgaggagcatgtagcttacagatgtttggactttgctacggtaaaactgagcattgttggtggacgacctttttctagtgggggaaaccagttatttcgattaaagcttttgtctgcaaggtatggagtccaagacatggatggaagtgctaagagaatctgcaaagcagctttgggtgctccagaggaccatatggtcattattcttgcacacaatggacccacaggtcttggttctaacttggatgacatatgtggaaaagactgggactttggaggtggagatcatggtgatgcagatctagcacaagccctgtccctcctaaaagagtccggcaaaacctgtgttccattggtagtgtttggtcacatgcataaacagctagcaggtggaaatggtcttcggaaaatgatcgtggttggagctgacaatactatatacctgaatgcgg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

211

Amino Acids

22.53

Weight (kDa)

6.22

Isoelectric Point (pI)

28.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 560
AasI GACNNNNNNGTC 2 cut(s) 377, 408
Acc36I ACCTGC 1 cut(s) 560
AccB7I CCANNNNNTGG 1 cut(s) 319
AciI CCGC 1 cut(s) 632
AcsI RAATTY 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 149
AfiI CCNNNNNNNGG 2 cut(s) 319, 631
AgsI TTSAA 2 cut(s) 80, 161
AjnI CCWGG 1 cut(s) 116
AjuI GAANNNNNNNTTGG 2 cut(s) 33, 65
AluBI AGCT 6 cut(s) 169, 197, 289, 353, 565, 608
AluI AGCT 6 cut(s) 169, 197, 289, 353, 565, 608
Alw21I GWGCWC 1 cut(s) 364
ApeKI GCWGC 3 cut(s) 4, 63, 350
ApoI RAATTY 1 cut(s) 80
ArsI GACNNNNNNTTYG 2 cut(s) 437, 469
AspS9I GGNCC 2 cut(s) 370, 401
AsuHPI GGTGA 3 cut(s) 41, 50, 485
AsuNHI GCTAGC 1 cut(s) 565
AvaII GGWCC 2 cut(s) 370, 401
BbsI GAAGAC 1 cut(s) 575
Bbv12I GWGCWC 1 cut(s) 364
BbvI GCAGC 3 cut(s) 16, 75, 362
BccI CCATC 1 cut(s) 317
BceAI ACGGC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 118
BfaI CTAG 5 cut(s) 170, 179, 258, 485, 566
BfuAI ACCTGC 1 cut(s) 560
BglII AGATCT 1 cut(s) 481
BisI GCNGC 3 cut(s) 5, 64, 351
BlsI GCNGC 3 cut(s) 6, 65, 352
Bme1390I CCNGG 1 cut(s) 118
Bme18I GGWCC 2 cut(s) 370, 401
BmgT120I GGNCC 2 cut(s) 370, 401
BmiI GGNNCC 1 cut(s) 403
BmrFI CCNGG 1 cut(s) 118
BmrI ACTGGG 1 cut(s) 457
BmsI GCATC 2 cut(s) 103, 466
BmtI GCTAGC 1 cut(s) 569
BmuI ACTGGG 1 cut(s) 457
BpiI GAAGAC 1 cut(s) 575
BpmI CTGGAG 1 cut(s) 348
BsaBI GATNNNNATC 1 cut(s) 480
Bsc4I CCNNNNNNNGG 2 cut(s) 319, 631
Bse1I ACTGG 2 cut(s) 271, 452
Bse8I GATNNNNATC 1 cut(s) 480
BseBI CCWGG 1 cut(s) 118
BseGI GGATG 2 cut(s) 328, 433
BseJI GATNNNNATC 1 cut(s) 480
BseLI CCNNNNNNNGG 2 cut(s) 319, 631
BseMII CTCAG 1 cut(s) 221
BseNI ACTGG 2 cut(s) 271, 452
BseRI GAGGAG 1 cut(s) 200
BseXI GCAGC 3 cut(s) 16, 75, 362
BsiHKAI GWGCWC 1 cut(s) 364
BsiSI CCGG 1 cut(s) 516
BslFI GGGAC 2 cut(s) 464, 484
BslI CCNNNNNNNGG 2 cut(s) 319, 631
BsmFI GGGAC 2 cut(s) 464, 484
BsmI GAATGC 1 cut(s) 634
Bsp1286I GDGCHC 1 cut(s) 364
Bsp143I GATC 3 cut(s) 466, 481, 594
BspACI CCGC 1 cut(s) 632
BspCNI CTCAG 1 cut(s) 222
BspLI GGNNCC 1 cut(s) 403
BspMI ACCTGC 1 cut(s) 560
BspOI GCTAGC 1 cut(s) 569
BsrI ACTGG 2 cut(s) 271, 452
BssMI GATC 3 cut(s) 466, 481, 594
Bst2UI CCWGG 1 cut(s) 118
Bst4CI ACNGT 2 cut(s) 176, 223
Bst6I CTCTTC 1 cut(s) 36
BstC8I GCNNGC 1 cut(s) 567
BstDEI CTNAG 2 cut(s) 230, 333
BstF5I GGATG 2 cut(s) 328, 433
BstKTI GATC 3 cut(s) 469, 484, 597
BstMBI GATC 3 cut(s) 466, 481, 594
BstMWI GCNNNNNNNGC 3 cut(s) 359, 485, 562
BstNI CCWGG 1 cut(s) 118
BstNSI RCATGY 2 cut(s) 194, 556
BstSCI CCNGG 1 cut(s) 116
BstV1I GCAGC 3 cut(s) 16, 75, 362
BstV2I GAAGAC 1 cut(s) 575
BstX2I RGATCY 1 cut(s) 481
BstYI RGATCY 1 cut(s) 481
BtsCI GGATG 2 cut(s) 328, 433
BveI ACCTGC 1 cut(s) 560
Cac8I GCNNGC 1 cut(s) 567
Cfr13I GGNCC 2 cut(s) 370, 401
CspCI CAANNNNNGTGG 2 cut(s) 394, 429
CviAII CATG 5 cut(s) 110, 191, 319, 470, 553
CviJI RGCY 8 cut(s) 7, 169, 197, 289, 353, 494, 565, 608
CviKI_1 RGCY 8 cut(s) 7, 169, 197, 289, 353, 494, 565, 608
DdeI CTNAG 2 cut(s) 230, 333
DpnI GATC 3 cut(s) 468, 483, 596
DpnII GATC 3 cut(s) 466, 481, 594
DrdI GACNNNNNNGTC 2 cut(s) 377, 408
DseDI GACNNNNNNGTC 2 cut(s) 377, 408
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco47I GGWCC 2 cut(s) 370, 401
Eco57I CTGAAG 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 116
EcoT22I ATGCAT 1 cut(s) 558
FaeI CATG 5 cut(s) 113, 194, 322, 473, 556
FaqI GGGAC 2 cut(s) 464, 484
FatI CATG 5 cut(s) 109, 190, 318, 469, 552
FauNDI CATATG 2 cut(s) 375, 434
Fnu4HI GCNGC 3 cut(s) 5, 64, 351
FokI GGATG 2 cut(s) 335, 440
Fsp4HI GCNGC 3 cut(s) 5, 64, 351
FspBI CTAG 5 cut(s) 170, 179, 258, 485, 566
GluI GCNGC 3 cut(s) 5, 64, 351
GsuI CTGGAG 1 cut(s) 348
HapII CCGG 1 cut(s) 516
Hin1II CATG 5 cut(s) 113, 194, 322, 473, 556
HindIII AAGCTT 1 cut(s) 287
HinfI GANTC 3 cut(s) 309, 339, 512
HpaII CCGG 1 cut(s) 516
HphI GGTGA 3 cut(s) 41, 50, 485
Hpy166II GTNNAC 1 cut(s) 245
Hpy188I TCNGA 1 cut(s) 588
Hpy188III TCNNGA 3 cut(s) 77, 138, 365
Hpy8I GTNNAC 1 cut(s) 245
HpyCH4III ACNGT 2 cut(s) 176, 223
HpyCH4V TGCA 7 cut(s) 4, 71, 299, 345, 392, 479, 556
HpyF10VI GCNNNNNNNGC 3 cut(s) 359, 485, 562
HpyF3I CTNAG 2 cut(s) 230, 333
Hsp92II CATG 5 cut(s) 113, 194, 322, 473, 556
Kzo9I GATC 3 cut(s) 466, 481, 594
LmnI GCTCC 3 cut(s) 187, 367, 605
Lsp1109I GCAGC 3 cut(s) 16, 75, 362
LweI GCATC 2 cut(s) 103, 466
MaeI CTAG 5 cut(s) 170, 179, 258, 485, 566
MaeIII GTNAC 1 cut(s) 548
MalI GATC 3 cut(s) 468, 483, 596
MboI GATC 3 cut(s) 466, 481, 594
MboII GAAGA 2 cut(s) 53, 575
MflI RGATCY 1 cut(s) 481
MhlI GDGCHC 1 cut(s) 364
MluCI AATT 2 cut(s) 54, 80
MlyI GAGTC 2 cut(s) 318, 521
MmeI TCCRAC 1 cut(s) 583
MnlI CCTC 4 cut(s) 178, 361, 452, 512
Mph1103I ATGCAT 1 cut(s) 558
MseI TTAA 1 cut(s) 284
MslI CAYNNNNRTG 1 cut(s) 474
MspI CCGG 1 cut(s) 516
MspR9I CCNGG 1 cut(s) 118
Mva1269I GAATGC 1 cut(s) 634
MvaI CCWGG 1 cut(s) 118
MwoI GCNNNNNNNGC 3 cut(s) 359, 485, 562
NdeI CATATG 2 cut(s) 375, 434
NdeII GATC 3 cut(s) 466, 481, 594
NheI GCTAGC 1 cut(s) 565
NlaIII CATG 5 cut(s) 113, 194, 322, 473, 556
NlaIV GGNNCC 1 cut(s) 403
NmuCI GTSAC 1 cut(s) 548
NsiI ATGCAT 1 cut(s) 558
NspI RCATGY 2 cut(s) 194, 556
PaqCI CACCTGC 1 cut(s) 560
PctI GAATGC 1 cut(s) 634
PfeI GAWTC 1 cut(s) 339
PflMI CCANNNNNTGG 1 cut(s) 319
PkrI GCNGC 3 cut(s) 6, 65, 352
PleI GAGTC 2 cut(s) 317, 520
PpsI GAGTC 2 cut(s) 317, 520
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 403
PspPI GGNCC 2 cut(s) 370, 401
PsuI RGATCY 1 cut(s) 481
RseI CAYNNNNRTG 1 cut(s) 474
SaqAI TTAA 1 cut(s) 284
SatI GCNGC 3 cut(s) 5, 64, 351
Sau3AI GATC 3 cut(s) 466, 481, 594
Sau96I GGNCC 2 cut(s) 370, 401
SchI GAGTC 2 cut(s) 318, 521
ScrFI CCNGG 1 cut(s) 118
SduI GDGCHC 1 cut(s) 364
SfaNI GCATC 2 cut(s) 103, 466
SinI GGWCC 2 cut(s) 370, 401
SmiMI CAYNNNNRTG 1 cut(s) 474
Sse9I AATT 2 cut(s) 54, 80
SsiI CCGC 1 cut(s) 632
SspMI CTAG 5 cut(s) 170, 179, 258, 485, 566
StyD4I CCNGG 1 cut(s) 116
TaaI ACNGT 2 cut(s) 176, 223
TaqI TCGA 1 cut(s) 280
TasI AATT 2 cut(s) 54, 80
TfiI GAWTC 1 cut(s) 339
Tru1I TTAA 1 cut(s) 284
Tru9I TTAA 1 cut(s) 284
TseFI GTSAC 1 cut(s) 548
TseI GCWGC 3 cut(s) 4, 63, 350
Tsp45I GTSAC 1 cut(s) 548
Van91I CCANNNNNTGG 1 cut(s) 319
VpaK11BI GGWCC 2 cut(s) 370, 401
XapI RAATTY 1 cut(s) 80
XceI RCATGY 2 cut(s) 194, 556
XcmI CCANNNNNNNNNTGG 1 cut(s) 320
XspI CTAG 5 cut(s) 170, 179, 258, 485, 566
Zsp2I ATGCAT 1 cut(s) 558
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.