Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004670.1

Orthogroup ID

OG0007805

Physical Location & Seq

Genomic Coordinates Reverse (-)

66438 .. 68621

Gene Structure 2184 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004670.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1224 bp

atgtctaagcaagcagaggaggaagtgtatattgggtcaattgaccaaggaaccaccagcaccagattcataatctatgatcatttggcgcgcccagttgggtctcaccaggtcgagttcactcaggtctacccggaagcaggatgggtggagcatgatccaatggagatattggagagcgtgagagtttgtatggctaaggctctggacaaggccaccgccgatgggcacaacgtcgacagtggattgaaggcgattgggttgaccaatcagagagaaaccactctcgtttggagtaaatccactggctgccctctttacaatgctattgtttggatggatgcccgtaccagttctgtttgcagaaaattggagaaagaattatctgggggcagaactcatttttcagagatatgtggtttgcccataagcacctatttcagtgctatgaagctgctatggttgatggagaatgtcgatactgttaaggaggctattaaatcaggggatgctctgtttggaactatagacacttggttaatctggaacttaaccggtggtctcaagggaggggtacatgtcacggatgtctccaacgcgtcacgcactatgctcatgaatcttaagactcttgagtgggatcaacccaccttggataccttgggaatttccgctacaattctccccaaaattgtcagcaactctgaggtcattggaaatattgccattggatggccaattactgggatcccaatttctggatgtttaggtgatcaacatgcagcaatgttaggtcaggcttgcaggaaaggtgaggccaagagcacttatggaactggtgcttttattcttctgaacactggtgaagagataactctgtcgaagcatgggcttctaagcactttgtcattcaaacttggacctaaagctcctgtaaattacgctctagaaggatccattgctattgctggagctgcagcggacatgatgggcagcccagttgtaaggccagctgatactgagacaacagctctcggagctgcttatgctgctggattagctgttggtgtttggactgaagaacagatctttgcttctgaagacaagacgaggacttccaccaccttccatccaaaaataggtgaagagttgaggaagaagaagttggagtcatggtgcaaagctgtttcaagaacttttgatttggccgatcttgcgctttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004370 GO:0005975 GO:0006066 GO:0006071 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019400 GO:0019751 GO:0044237 GO:0044238 GO:0044262 GO:0044281 GO:0071704 GO:1901615

KEGG Pathways

Metabolic & Signaling

ko00561 ko01100 ko03320 ko04626 map00561 map01100 map03320 map04626

Pfam Domains

Protein Families

FGGY_C FGGY_N

Protein Analysis

407

Amino Acids

43.89

Weight (kDa)

5.56

Isoelectric Point (pI)

27.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007805)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G80460 AT1G80460
fragaria_vesca	FvH4_6g29330
malus_domestica	MD09G1222300.v1.1 MD17G1215600.v1.1
prunus_persica	Prupe.3G091800_v2.0.a1
pyrus_communis	pycom17g22010 pycom808g00550
rosa_chinensis	RchiOBHm_Chr2g0134571
rosa_laevigata	RLG00000019403 RLG00000019410
rosa_multiflora	Rmu_sc0002792.1_g000034 Rmu_sc0004670.1_g000014 Rmu_ssc0000438.1_g000039
rosa_roxburghii	Rroxscaffold_2G00110000
rosa_rugosa	Rorug02G0318500 Rorug02G0318600 Rorug06G0124200
rosa_samantha	Rh2AG374800 Rh2BG376400 Rh2CG355000 Rh6AG233000 Rh6DG231400
rosa_wichuraiana	Rw2G030210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	3 cut(s)	732, 743, 758
AccI	GTMKAC	2 cut(s)	129, 237
AccII	CGCG	2 cut(s)	91, 599
AciI	CCGC	3 cut(s)	219, 672, 980
AclWI	GGATC	6 cut(s)	152, 648, 742, 755, 948, 961
AcoI	YGGCCR	2 cut(s)	734, 1206
AcsI	RAATTY	1 cut(s)	666
AcuI	CTGAAG	2 cut(s)	1098, 1119
AfaI	GTAC	2 cut(s)	349, 576
AfiI	CCNNNNNNNGG	6 cut(s)	140, 225, 732, 743, 758, 1139
AflII	CTTAAG	1 cut(s)	623
AflIII	ACRYGT	2 cut(s)	577, 597
AgeI	ACCGGT	1 cut(s)	554
AgsI	TTSAA	3 cut(s)	250, 913, 1191
AjnI	CCWGG	1 cut(s)	108
AjuI	GAANNNNNNNTTGG	4 cut(s)	15, 47, 1148, 1180
AluBI	AGCT	8 cut(s)	454, 929, 974, 1013, 1031, 1040, 1061, 1184
AluI	AGCT	8 cut(s)	454, 929, 974, 1013, 1031, 1040, 1061, 1184
Alw21I	GWGCWC	1 cut(s)	827
Alw26I	GTCTC	4 cut(s)	108, 566, 595, 1016
AlwI	GGATC	6 cut(s)	152, 648, 742, 755, 948, 961
AoxI	GGCC	5 cut(s)	213, 734, 816, 1007, 1206
ApeKI	GCWGC	8 cut(s)	309, 454, 782, 974, 977, 993, 1040, 1049
ApoI	RAATTY	1 cut(s)	666
AscI	GGCGCGCC	1 cut(s)	89
AsiGI	ACCGGT	1 cut(s)	554
AspLEI	GCGC	3 cut(s)	91, 93, 1219
AspS9I	GGNCC	1 cut(s)	920
AsuC2I	CCSGG	1 cut(s)	134
AsuHPI	GGTGA	5 cut(s)	98, 782, 824, 875, 1154
AvaII	GGWCC	1 cut(s)	920
BaeGI	GKGCMC	1 cut(s)	231
BalI	TGGCCA	1 cut(s)	736
BamHI	GGATCC	2 cut(s)	747, 953
BbsI	GAAGAC	1 cut(s)	1107
Bbv12I	GWGCWC	1 cut(s)	827
BbvI	GCAGC	8 cut(s)	296, 441, 794, 961, 989, 1005, 1027, 1036
BccI	CCATC	7 cut(s)	138, 218, 331, 460, 726, 982, 1137
BciT130I	CCWGG	1 cut(s)	110
BciVI	GTATCC	1 cut(s)	649
BclI	TGATCA	2 cut(s)	79, 772
BcnI	CCSGG	1 cut(s)	134
BcoDI	GTCTC	4 cut(s)	108, 566, 595, 1016
BfaI	CTAG	1 cut(s)	947
BfmI	CTRYAG	2 cut(s)	525, 975
BfrI	CTTAAG	1 cut(s)	623
BfuI	GTATCC	1 cut(s)	649
BglII	AGATCT	1 cut(s)	1086
BisI	GCNGC	8 cut(s)	310, 455, 783, 975, 978, 994, 1041, 1050
BlsI	GCNGC	8 cut(s)	311, 456, 784, 976, 979, 995, 1042, 1051
Bme1390I	CCNGG	2 cut(s)	110, 134
Bme18I	GGWCC	1 cut(s)	920
BmgT120I	GGNCC	1 cut(s)	920
BmiI	GGNNCC	3 cut(s)	52, 749, 955
BmrFI	CCNGG	2 cut(s)	110, 134
BmrI	ACTGGG	3 cut(s)	89, 753, 992
BmsI	GCATC	2 cut(s)	331, 499
BmuI	ACTGGG	3 cut(s)	89, 753, 992
BpiI	GAAGAC	1 cut(s)	1107
BpmI	CTGGAG	1 cut(s)	990
Bpu10I	CCTNAGC	1 cut(s)	198
BpuEI	CTTGAG	2 cut(s)	548, 653
BpuMI	CCSGG	1 cut(s)	134
BsaI	GGTCTC	2 cut(s)	108, 566
BsaJI	CCNNGG	3 cut(s)	46, 651, 660
BsaWI	WCCGGW	1 cut(s)	554
BsaXI	ACNNNNNCTCC	4 cut(s)	11, 41, 1160, 1190
Bsc4I	CCNNNNNNNGG	6 cut(s)	140, 225, 732, 743, 758, 1139
Bse118I	RCCGGY	1 cut(s)	554
Bse1I	ACTGG	7 cut(s)	95, 310, 351, 748, 841, 865, 998
Bse3DI	GCAATG	2 cut(s)	792, 957
BseBI	CCWGG	1 cut(s)	110
BseDI	CCNNGG	3 cut(s)	46, 651, 660
BseGI	GGATG	8 cut(s)	149, 342, 346, 514, 592, 737, 767, 1129
BseLI	CCNNNNNNNGG	6 cut(s)	140, 225, 732, 743, 758, 1139
BseMI	GCAATG	2 cut(s)	792, 957
BseMII	CTCAG	3 cut(s)	137, 696, 1011
BseNI	ACTGG	7 cut(s)	95, 310, 351, 748, 841, 865, 998
BsePI	GCGCGC	1 cut(s)	89
BseRI	GAGGAG	1 cut(s)	32
BseSI	GKGCMC	1 cut(s)	231
BseXI	GCAGC	8 cut(s)	296, 441, 794, 961, 989, 1005, 1027, 1036
Bsh1236I	CGCG	2 cut(s)	91, 599
BshFI	GGCC	5 cut(s)	215, 736, 818, 1009, 1208
BshTI	ACCGGT	1 cut(s)	554
BsiHKAI	GWGCWC	1 cut(s)	827
BsiSI	CCGG	2 cut(s)	134, 555
BslI	CCNNNNNNNGG	6 cut(s)	140, 225, 732, 743, 758, 1139
BsmAI	GTCTC	4 cut(s)	108, 566, 595, 1016
BsnI	GGCC	5 cut(s)	215, 736, 818, 1009, 1208
Bso31I	GGTCTC	2 cut(s)	108, 566
Bsp1286I	GDGCHC	2 cut(s)	231, 827
Bsp143I	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
BspACI	CCGC	3 cut(s)	219, 672, 980
BspANI	GGCC	5 cut(s)	215, 736, 818, 1009, 1208
BspCNI	CTCAG	3 cut(s)	136, 697, 1012
BspFNI	CGCG	2 cut(s)	91, 599
BspHI	TCATGA	1 cut(s)	615
BspLI	GGNNCC	3 cut(s)	52, 749, 955
BspMAI	CTGCAG	1 cut(s)	979
BspPI	GGATC	6 cut(s)	152, 648, 742, 755, 948, 961
BspTI	CTTAAG	1 cut(s)	623
BspTNI	GGTCTC	2 cut(s)	108, 566
BsrDI	GCAATG	2 cut(s)	792, 957
BsrFI	RCCGGY	1 cut(s)	554
BsrI	ACTGG	7 cut(s)	95, 310, 351, 748, 841, 865, 998
BssAI	RCCGGY	1 cut(s)	554
BssECI	CCNNGG	3 cut(s)	46, 651, 660
BssHII	GCGCGC	1 cut(s)	89
BssMI	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
BssT1I	CCWWGG	3 cut(s)	46, 651, 660
Bst2UI	CCWGG	1 cut(s)	110
Bst4CI	ACNGT	2 cut(s)	242, 484
Bst6I	CTCTTC	2 cut(s)	861, 1140
BstAFI	CTTAAG	1 cut(s)	623
BstC8I	GCNNGC	4 cut(s)	12, 91, 802, 1011
BstDEI	CTNAG	6 cut(s)	6, 123, 198, 705, 896, 1020
BstF5I	GGATG	8 cut(s)	149, 342, 346, 514, 592, 737, 767, 1129
BstFNI	CGCG	2 cut(s)	91, 599
BstHHI	GCGC	3 cut(s)	91, 93, 1219
BstKTI	GATC	8 cut(s)	82, 160, 643, 750, 775, 956, 1089, 1213
BstMAI	GTCTC	4 cut(s)	108, 566, 595, 1016
BstMBI	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
BstMWI	GCNNNNNNNGC	6 cut(s)	974, 1037, 1046, 1049, 1058, 1214
BstNI	CCWGG	1 cut(s)	110
BstNSI	RCATGY	2 cut(s)	581, 782
BstSCI	CCNGG	2 cut(s)	108, 132
BstSFI	CTRYAG	2 cut(s)	525, 975
BstSLI	GKGCMC	1 cut(s)	231
BstUI	CGCG	2 cut(s)	91, 599
BstV1I	GCAGC	8 cut(s)	296, 441, 794, 961, 989, 1005, 1027, 1036
BstV2I	GAAGAC	1 cut(s)	1107
BstX2I	RGATCY	3 cut(s)	747, 953, 1086
BstYI	RGATCY	3 cut(s)	747, 953, 1086
BsuI	GTATCC	1 cut(s)	649
BsuRI	GGCC	5 cut(s)	215, 736, 818, 1009, 1208
BtsCI	GGATG	8 cut(s)	149, 342, 346, 514, 592, 737, 767, 1129
BtsIMutI	CAGTG	4 cut(s)	247, 303, 448, 858
Cac8I	GCNNGC	4 cut(s)	12, 91, 802, 1011
CciI	TCATGA	1 cut(s)	615
CfoI	GCGC	3 cut(s)	91, 93, 1219
Cfr10I	RCCGGY	1 cut(s)	554
Cfr13I	GGNCC	1 cut(s)	920
CseI	GACGC	1 cut(s)	588
CsiI	ACCWGGT	1 cut(s)	108
Csp6I	GTAC	2 cut(s)	348, 575
CspAI	ACCGGT	1 cut(s)	554
CviAII	CATG	7 cut(s)	155, 578, 616, 779, 887, 985, 1173
CviQI	GTAC	2 cut(s)	348, 575
DdeI	CTNAG	6 cut(s)	6, 123, 198, 705, 896, 1020
DpnI	GATC	8 cut(s)	81, 159, 642, 749, 774, 955, 1088, 1212
DpnII	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
EaeI	YGGCCR	2 cut(s)	734, 1206
Eam1104I	CTCTTC	2 cut(s)	861, 1140
EarI	CTCTTC	2 cut(s)	861, 1140
Eco130I	CCWWGG	3 cut(s)	46, 651, 660
Eco31I	GGTCTC	2 cut(s)	108, 566
Eco47I	GGWCC	1 cut(s)	920
Eco57I	CTGAAG	2 cut(s)	1098, 1119
EcoRII	CCWGG	1 cut(s)	108
EcoT14I	CCWWGG	3 cut(s)	46, 651, 660
ErhI	CCWWGG	3 cut(s)	46, 651, 660
FaeI	CATG	7 cut(s)	158, 581, 619, 782, 890, 988, 1176
FatI	CATG	7 cut(s)	154, 577, 615, 778, 886, 984, 1172
FbaI	TGATCA	2 cut(s)	79, 772
FblI	GTMKAC	2 cut(s)	129, 237
Fnu4HI	GCNGC	8 cut(s)	310, 455, 783, 975, 978, 994, 1041, 1050
FokI	GGATG	8 cut(s)	156, 349, 353, 521, 599, 744, 774, 1116
Fsp4HI	GCNGC	8 cut(s)	310, 455, 783, 975, 978, 994, 1041, 1050
FspBI	CTAG	1 cut(s)	947
GlaI	GCGC	3 cut(s)	90, 92, 1218
GluI	GCNGC	8 cut(s)	310, 455, 783, 975, 978, 994, 1041, 1050
GsuI	CTGGAG	1 cut(s)	990
HaeIII	GGCC	5 cut(s)	215, 736, 818, 1009, 1208
HapII	CCGG	2 cut(s)	134, 555
HgaI	GACGC	1 cut(s)	588
HhaI	GCGC	3 cut(s)	91, 93, 1219
Hin1II	CATG	7 cut(s)	158, 581, 619, 782, 890, 988, 1176
Hin6I	GCGC	3 cut(s)	89, 91, 1217
HinP1I	GCGC	3 cut(s)	89, 91, 1217
HincII	GTYRAC	2 cut(s)	238, 264
HindII	GTYRAC	2 cut(s)	238, 264
HinfI	GANTC	4 cut(s)	66, 619, 628, 1169
HpaII	CCGG	2 cut(s)	134, 555
HphI	GGTGA	5 cut(s)	98, 782, 824, 875, 1154
Hpy166II	GTNNAC	4 cut(s)	120, 130, 238, 264
Hpy188I	TCNGA	6 cut(s)	273, 409, 706, 855, 1037, 1099
Hpy188III	TCNNGA	7 cut(s)	206, 544, 616, 632, 759, 947, 1191
Hpy8I	GTNNAC	4 cut(s)	120, 130, 238, 264
Hpy99I	CGWCG	1 cut(s)	239
HpyAV	CCTTC	3 cut(s)	244, 944, 1135
HpyCH4III	ACNGT	2 cut(s)	242, 484
HpyCH4IV	ACGT	1 cut(s)	234
HpyCH4V	TGCA	5 cut(s)	363, 782, 804, 977, 1179
HpyF10VI	GCNNNNNNNGC	6 cut(s)	974, 1037, 1046, 1049, 1058, 1214
HpyF3I	CTNAG	6 cut(s)	6, 123, 198, 705, 896, 1020
HpySE526I	ACGT	1 cut(s)	234
Hsp92II	CATG	7 cut(s)	158, 581, 619, 782, 890, 988, 1176
HspAI	GCGC	3 cut(s)	89, 91, 1217
Ksp22I	TGATCA	2 cut(s)	79, 772
Kzo9I	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
LmnI	GCTCC	4 cut(s)	151, 934, 971, 1037
Lsp1109I	GCAGC	8 cut(s)	296, 441, 794, 961, 989, 1005, 1027, 1036
LweI	GCATC	2 cut(s)	331, 499
MabI	ACCWGGT	1 cut(s)	108
MaeI	CTAG	1 cut(s)	947
MaeII	ACGT	1 cut(s)	234
MaeIII	GTNAC	2 cut(s)	580, 600
MalI	GATC	8 cut(s)	81, 159, 642, 749, 774, 955, 1088, 1212
MboI	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
MboII	GAAGA	7 cut(s)	842, 878, 1091, 1112, 1157, 1168, 1171
MfeI	CAATTG	1 cut(s)	39
MflI	RGATCY	3 cut(s)	747, 953, 1086
MhlI	GDGCHC	2 cut(s)	231, 827
MlsI	TGGCCA	1 cut(s)	736
MluCI	AATT	9 cut(s)	39, 368, 380, 666, 678, 690, 738, 753, 937
MluI	ACGCGT	1 cut(s)	597
MluNI	TGGCCA	1 cut(s)	736
MlyI	GAGTC	2 cut(s)	622, 1178
MmeI	TCCRAC	2 cut(s)	618, 1146
MnlI	CCTC	9 cut(s)	10, 13, 324, 484, 563, 700, 808, 1104, 1146
Mox20I	TGGCCA	1 cut(s)	736
MscI	TGGCCA	1 cut(s)	736
MseI	TTAA	5 cut(s)	486, 498, 539, 551, 624
Msp20I	TGGCCA	1 cut(s)	736
MspA1I	CMGCKG	2 cut(s)	980, 1013
MspCI	CTTAAG	1 cut(s)	623
MspI	CCGG	2 cut(s)	134, 555
MspR9I	CCNGG	2 cut(s)	110, 134
MunI	CAATTG	1 cut(s)	39
MvaI	CCWGG	1 cut(s)	110
MvnI	CGCG	2 cut(s)	91, 599
MwoI	GCNNNNNNNGC	6 cut(s)	974, 1037, 1046, 1049, 1058, 1214
NciI	CCSGG	1 cut(s)	134
NdeII	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
NlaIII	CATG	7 cut(s)	158, 581, 619, 782, 890, 988, 1176
NlaIV	GGNNCC	3 cut(s)	52, 749, 955
NmuCI	GTSAC	2 cut(s)	580, 600
NspI	RCATGY	2 cut(s)	581, 782
PagI	TCATGA	1 cut(s)	615
PalAI	GGCGCGCC	1 cut(s)	89
PauI	GCGCGC	1 cut(s)	89
PciI	ACATGT	1 cut(s)	577
PfeI	GAWTC	2 cut(s)	66, 619
PflMI	CCANNNNNTGG	3 cut(s)	732, 743, 758
PinAI	ACCGGT	1 cut(s)	554
PkrI	GCNGC	8 cut(s)	311, 456, 784, 976, 979, 995, 1042, 1051
PleI	GAGTC	2 cut(s)	622, 1177
PpsI	GAGTC	2 cut(s)	622, 1177
PscI	ACATGT	1 cut(s)	577
Psp6I	CCWGG	1 cut(s)	108
PspGI	CCWGG	1 cut(s)	108
PspN4I	GGNNCC	3 cut(s)	52, 749, 955
PspPI	GGNCC	1 cut(s)	920
PstI	CTGCAG	1 cut(s)	979
PsuI	RGATCY	3 cut(s)	747, 953, 1086
PteI	GCGCGC	1 cut(s)	89
PvuII	CAGCTG	1 cut(s)	1013
RsaI	GTAC	2 cut(s)	349, 576
RsaNI	GTAC	2 cut(s)	348, 575
SalI	GTCGAC	1 cut(s)	236
SaqAI	TTAA	5 cut(s)	486, 498, 539, 551, 624
SatI	GCNGC	8 cut(s)	310, 455, 783, 975, 978, 994, 1041, 1050
Sau3AI	GATC	8 cut(s)	79, 157, 640, 747, 772, 953, 1086, 1210
Sau96I	GGNCC	1 cut(s)	920
SchI	GAGTC	2 cut(s)	622, 1178
ScrFI	CCNGG	2 cut(s)	110, 134
SduI	GDGCHC	2 cut(s)	231, 827
SexAI	ACCWGGT	1 cut(s)	108
SfaNI	GCATC	2 cut(s)	331, 499
SfcI	CTRYAG	2 cut(s)	525, 975
SgsI	GGCGCGCC	1 cut(s)	89
SinI	GGWCC	1 cut(s)	920
SmlI	CTYRAG	3 cut(s)	563, 623, 632
SmoI	CTYRAG	3 cut(s)	563, 623, 632
Sse9I	AATT	9 cut(s)	39, 368, 380, 666, 678, 690, 738, 753, 937
SsiI	CCGC	3 cut(s)	219, 672, 980
SspI	AATATT	1 cut(s)	721
SspMI	CTAG	1 cut(s)	947
StyD4I	CCNGG	2 cut(s)	108, 132
StyI	CCWWGG	3 cut(s)	46, 651, 660
TaaI	ACNGT	2 cut(s)	242, 484
TaiI	ACGT	1 cut(s)	237
TaqI	TCGA	4 cut(s)	114, 237, 477, 881
TasI	AATT	9 cut(s)	39, 368, 380, 666, 678, 690, 738, 753, 937
TfiI	GAWTC	2 cut(s)	66, 619
Tru1I	TTAA	5 cut(s)	486, 498, 539, 551, 624
Tru9I	TTAA	5 cut(s)	486, 498, 539, 551, 624
TscAI	CASTG	4 cut(s)	247, 310, 448, 865
TseFI	GTSAC	2 cut(s)	580, 600
TseI	GCWGC	8 cut(s)	309, 454, 782, 974, 977, 993, 1040, 1049
Tsp45I	GTSAC	2 cut(s)	580, 600
TspDTI	ATGAA	3 cut(s)	58, 464, 632
TspGWI	ACGGA	1 cut(s)	599
TspRI	CASTG	4 cut(s)	247, 310, 448, 865
Van91I	CCANNNNNTGG	3 cut(s)	732, 743, 758
Vha464I	CTTAAG	1 cut(s)	623
VpaK11BI	GGWCC	1 cut(s)	920
XapI	RAATTY	1 cut(s)	666
XbaI	TCTAGA	1 cut(s)	946
XceI	RCATGY	2 cut(s)	581, 782
XmiI	GTMKAC	2 cut(s)	129, 237
XspI	CTAG	1 cut(s)	947

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.