Rmu_sc0004704.1_g000006

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004704.1
OG0012666
Physical Location & Seq
Forward (+)
33204 .. 33554
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004704.1_g000006.1.cds

Sequence Viewer

Length: 351 bp
atgacctgttgcaatggagagtcaaggagaggccccgagctttgtaatggtccaacttgtcgagtttgcaggttaattaagtcgaacttcgactcagaatatgtattggagaatgggattcagttaagtacaagtagtgaaaacaccattgccgttgcgagggcagccaaggcaaagagggctgtaatagtttgcaggacaattgcagggagcattattaatgtggaggacaaggaatatgacgagtctgattcaattggaaaccgaaatttgcattccaccaccacagaatatcttttggtgcagaatcccagtgctgtacttccctgttttgtagtagttttcaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

12.69

Weight (kDa)

5.8

Isoelectric Point (pI)

31.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 60
AcsI RAATTY 1 cut(s) 268
AfaI GTAC 2 cut(s) 130, 321
AfiI CCNNNNNNNGG 1 cut(s) 159
AgsI TTSAA 2 cut(s) 255, 346
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
Ama87I CYCGRG 1 cut(s) 35
AoxI GGCC 1 cut(s) 31
ApeKI GCWGC 1 cut(s) 164
ApoI RAATTY 1 cut(s) 268
AseI ATTAAT 1 cut(s) 219
AspS9I GGNCC 2 cut(s) 32, 50
AvaI CYCGRG 1 cut(s) 35
AvaII GGWCC 1 cut(s) 50
BbvI GCAGC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 137
BfuAI ACCTGC 1 cut(s) 60
BisI GCNGC 1 cut(s) 165
BlsI GCNGC 1 cut(s) 166
Bme18I GGWCC 1 cut(s) 50
BmeT110I CYCGRG 1 cut(s) 35
BmgT120I GGNCC 2 cut(s) 32, 50
BmiI GGNNCC 1 cut(s) 34
BmrI ACTGGG 1 cut(s) 306
BmuI ACTGGG 1 cut(s) 306
BsaJI CCNNGG 1 cut(s) 168
Bsc4I CCNNNNNNNGG 1 cut(s) 159
Bse1I ACTGG 1 cut(s) 312
Bse3DI GCAATG 2 cut(s) 19, 147
BseDI CCNNGG 1 cut(s) 168
BseLI CCNNNNNNNGG 1 cut(s) 159
BseMI GCAATG 2 cut(s) 19, 147
BseMII CTCAG 1 cut(s) 108
BseNI ACTGG 1 cut(s) 312
BseXI GCAGC 1 cut(s) 176
BsgI GTGCAG 1 cut(s) 323
BshFI GGCC 1 cut(s) 33
BsiHKCI CYCGRG 1 cut(s) 35
BslI CCNNNNNNNGG 1 cut(s) 159
BsmI GAATGC 1 cut(s) 274
BsnI GGCC 1 cut(s) 33
BsoBI CYCGRG 1 cut(s) 35
BspANI GGCC 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 107
BspLI GGNNCC 1 cut(s) 34
BspMI ACCTGC 1 cut(s) 60
BsrDI GCAATG 2 cut(s) 19, 147
BsrI ACTGG 1 cut(s) 312
BssECI CCNNGG 1 cut(s) 168
BssT1I CCWWGG 1 cut(s) 168
BstDEI CTNAG 1 cut(s) 94
BstMWI GCNNNNNNNGC 3 cut(s) 164, 170, 179
BstV1I GCAGC 1 cut(s) 176
BsuRI GGCC 1 cut(s) 33
BtsIMutI CAGTG 1 cut(s) 319
BveI ACCTGC 1 cut(s) 60
Cfr13I GGNCC 2 cut(s) 32, 50
Csp6I GTAC 2 cut(s) 129, 320
CviJI RGCY 4 cut(s) 33, 40, 167, 182
CviKI_1 RGCY 4 cut(s) 33, 40, 167, 182
CviQI GTAC 2 cut(s) 129, 320
DdeI CTNAG 1 cut(s) 94
Eco130I CCWWGG 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 50
Eco88I CYCGRG 1 cut(s) 35
EcoO109I RGGNCCY 1 cut(s) 32
EcoT14I CCWWGG 1 cut(s) 168
ErhI CCWWGG 1 cut(s) 168
FaiI YATR 2 cut(s) 102, 240
FalI AAGNNNNNCTT 2 cut(s) 71, 103
Fnu4HI GCNGC 1 cut(s) 165
Fsp4HI GCNGC 1 cut(s) 165
GluI GCNGC 1 cut(s) 165
HaeIII GGCC 1 cut(s) 33
HinfI GANTC 6 cut(s) 20, 92, 118, 245, 251, 307
Hpy188I TCNGA 2 cut(s) 97, 250
HpyCH4V TGCA 6 cut(s) 12, 69, 195, 206, 274, 304
HpyF10VI GCNNNNNNNGC 3 cut(s) 164, 170, 179
HpyF3I CTNAG 1 cut(s) 94
LmnI GCTCC 1 cut(s) 210
LpnPI CCDG 6 cut(s) 19, 55, 181, 192, 325, 340
Lsp1109I GCAGC 1 cut(s) 176
MfeI CAATTG 2 cut(s) 201, 255
MluCI AATT 4 cut(s) 75, 201, 255, 268
MlyI GAGTC 3 cut(s) 29, 86, 254
MmeI TCCRAC 1 cut(s) 77
MnlI CCTC 4 cut(s) 23, 153, 171, 220
MseI TTAA 4 cut(s) 74, 78, 125, 219
MunI CAATTG 2 cut(s) 201, 255
Mva1269I GAATGC 1 cut(s) 274
MwoI GCNNNNNNNGC 3 cut(s) 164, 170, 179
NlaIV GGNNCC 1 cut(s) 34
PacI TTAATTAA 1 cut(s) 78
PctI GAATGC 1 cut(s) 274
PfeI GAWTC 3 cut(s) 118, 251, 307
PkrI GCNGC 1 cut(s) 166
PleI GAGTC 3 cut(s) 28, 86, 253
PpsI GAGTC 3 cut(s) 28, 86, 253
PshBI ATTAAT 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 34
PspPI GGNCC 2 cut(s) 32, 50
RsaI GTAC 2 cut(s) 130, 321
RsaNI GTAC 2 cut(s) 129, 320
SaqAI TTAA 4 cut(s) 74, 78, 125, 219
SatI GCNGC 1 cut(s) 165
Sau96I GGNCC 2 cut(s) 32, 50
SchI GAGTC 3 cut(s) 29, 86, 254
SetI ASST 3 cut(s) 8, 42, 74
SinI GGWCC 1 cut(s) 50
Sse9I AATT 4 cut(s) 75, 201, 255, 268
StyI CCWWGG 1 cut(s) 168
TaqI TCGA 3 cut(s) 61, 83, 90
TasI AATT 4 cut(s) 75, 201, 255, 268
TatI WGTACW 2 cut(s) 128, 319
TfiI GAWTC 3 cut(s) 118, 251, 307
Tru1I TTAA 4 cut(s) 74, 78, 125, 219
Tru9I TTAA 4 cut(s) 74, 78, 125, 219
TscAI CASTG 1 cut(s) 319
TseI GCWGC 1 cut(s) 164
TspRI CASTG 1 cut(s) 319
VpaK11BI GGWCC 1 cut(s) 50
VspI ATTAAT 1 cut(s) 219
XapI RAATTY 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.