Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004811.1

Orthogroup ID

OG0006197

Physical Location & Seq

Genomic Coordinates Forward (+)

6068 .. 7171

Gene Structure 1104 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004811.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1104 bp

atggttatacatctcaaatttcgcaacttttcgttcccaattcaatccaaaaggtcagaaaccctaaacccttttacgctgttcattagacattgtcattttcaatcgaacccacctttcaattctccatatttggcaccacccaagatttcccaaaccagcgttgcaattttctgggatttagaaaccaaacccccaaaatcagtcacgccgttcgaggccgccggcaggctcaagacggcggcttcgtcgttcgggctcgtcaggcatatgatcgcatacgccaaccgccacgcgtttaatagtgttcctcaagttgtggggaagataaggaaagagaggaatagggtagtgattagggatgagcccaacatttgtagggtatgtgggaggaggttttatactaaagagaagcttatgaatcattttaagctgcatgagagggaacacacgaagaggttgagtcaaattgagtcggcgagagggagtaggagggtgaaattggtggggaagtattcaatgaagatggagaagtataagaatgctgtgagggatgtgatgataccaaaggaagggaattgtttggttagtgagatgaagcgggcggggttttgggttcggagtttggctgataagccacaggctggatttgttgcattgagaaatgacattttggagatgatggatcagaggaggtttgagtgtttggtgcttgtttcggatgattcggattttgtggatgttgtgatggaggcgaggaggagatgtgtgaagacggttgctgtgggggatttaggtgatggggctctgaagagggctgcggattcagggttttcttggagggagattttgttggggaaggctaagaaggaggctgtggcggttgtggggaagtggaaagaccgtgatatattgaagagattggagtggaaatacaagccagatgaggataggagggtgcatagcttggatggtggagttgatggtgagtgtgaggatgaggaaattggaagtattgttggtgggatgaatgacaattgtttgcggagcgatgataccggcaaatggtgggagcttgactctgatgctgatgccatttcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NYN

Protein Analysis

367

Amino Acids

42.02

Weight (kDa)

9.44

Isoelectric Point (pI)

48.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006197)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G12240
fragaria_vesca	FvH4_5g00630 FvH4_5g00630 FvH4_5g00630 FvH4_5g00630 FvH4_5g00630 FvH4_5g00630 FvH4_5g00630 FvH4_5g00630 FvH4_5g00630
malus_domestica	MD09G1283800.v1.1
prunus_persica	Prupe.2G054400_v2.0.a1 Prupe.2G054600_v2.0.a1 Prupe.5G079100_v2.0.a1 Prupe.5G079100_v2.0.a1 Prupe.5G079100_v2.0.a1
pyrus_communis	pycom09g19170
rosa_chinensis	RchiOBHm_Chr7g0201631
rosa_laevigata	RLG00000003660
rosa_multiflora	Rmu_sc0004811.1_g000002
rosa_roxburghii	Rroxscaffold_3G00255180
rosa_rugosa	Rorug07G0065200
rosa_samantha	Rh7AG192000 Rh7BG194200 Rh7CG203200 Rh7DG197200
rosa_wichuraiana	Rw7G016840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	136
AccB7I	CCANNNNNTGG	1 cut(s)	644
AccII	CGCG	1 cut(s)	296
AciI	CCGC	8 cut(s)	222, 242, 289, 601, 605, 821, 881, 1045
AclWI	GGATC	1 cut(s)	693
AcsI	RAATTY	1 cut(s)	17
AcuI	CTGAAG	1 cut(s)	830
AfiI	CCNNNNNNNGG	4 cut(s)	228, 572, 644, 1065
AflIII	ACRYGT	1 cut(s)	294
AgsI	TTSAA	5 cut(s)	44, 104, 121, 519, 916
AluBI	AGCT	4 cut(s)	415, 433, 966, 1075
AluI	AGCT	4 cut(s)	415, 433, 966, 1075
AlwI	GGATC	1 cut(s)	693
AoxI	GGCC	1 cut(s)	219
ApeKI	GCWGC	2 cut(s)	433, 818
ApoI	RAATTY	1 cut(s)	17
ArsI	GACNNNNNNTTYG	2 cut(s)	229, 261
AsuHPI	GGTGA	3 cut(s)	508, 809, 998
BanI	GGYRCC	1 cut(s)	136
BanII	GRGCYC	3 cut(s)	261, 369, 808
BbsI	GAAGAC	1 cut(s)	779
BbvI	GCAGC	2 cut(s)	420, 805
BccI	CCATC	6 cut(s)	520, 676, 742, 794, 965, 977
BceAI	ACGGC	2 cut(s)	196, 255
BisI	GCNGC	4 cut(s)	222, 243, 434, 819
BlsI	GCNGC	4 cut(s)	223, 244, 435, 820
BmiI	GGNNCC	1 cut(s)	138
BmsI	GCATC	2 cut(s)	1075, 1081
BpiI	GAAGAC	1 cut(s)	779
BplI	GAGNNNNNCTC	2 cut(s)	1064, 1096
BpuEI	CTTGAG	2 cut(s)	218, 297
BsaXI	ACNNNNNCTCC	4 cut(s)	751, 781, 836, 866
Bsc4I	CCNNNNNNNGG	4 cut(s)	228, 572, 644, 1065
Bse118I	RCCGGY	2 cut(s)	224, 1058
BseGI	GGATG	7 cut(s)	367, 559, 727, 745, 976, 1003, 1032
BseLI	CCNNNNNNNGG	4 cut(s)	228, 572, 644, 1065
BseRI	GAGGAG	4 cut(s)	406, 706, 772, 775
BseXI	GCAGC	2 cut(s)	420, 805
Bsh1236I	CGCG	1 cut(s)	296
BshFI	GGCC	1 cut(s)	221
BshNI	GGYRCC	1 cut(s)	136
BsiSI	CCGG	2 cut(s)	225, 1059
BslI	CCNNNNNNNGG	4 cut(s)	228, 572, 644, 1065
BsmI	GAATGC	1 cut(s)	547
BsnI	GGCC	1 cut(s)	221
Bsp1286I	GDGCHC	3 cut(s)	261, 369, 808
Bsp143I	GATC	2 cut(s)	273, 685
BspACI	CCGC	8 cut(s)	222, 242, 289, 601, 605, 821, 881, 1045
BspANI	GGCC	1 cut(s)	221
BspFNI	CGCG	1 cut(s)	296
BspLI	GGNNCC	1 cut(s)	138
BspPI	GGATC	1 cut(s)	693
BspT107I	GGYRCC	1 cut(s)	136
BsrFI	RCCGGY	2 cut(s)	224, 1058
BssAI	RCCGGY	2 cut(s)	224, 1058
BssMI	GATC	2 cut(s)	273, 685
Bst4CI	ACNGT	2 cut(s)	778, 905
Bst6I	CTCTTC	3 cut(s)	449, 806, 911
BstC8I	GCNNGC	3 cut(s)	226, 230, 603
BstDEI	CTNAG	1 cut(s)	864
BstF5I	GGATG	7 cut(s)	367, 559, 727, 745, 976, 1003, 1032
BstFNI	CGCG	1 cut(s)	296
BstKTI	GATC	2 cut(s)	276, 688
BstMBI	GATC	2 cut(s)	273, 685
BstMWI	GCNNNNNNNGC	1 cut(s)	265
BstUI	CGCG	1 cut(s)	296
BstV1I	GCAGC	2 cut(s)	420, 805
BstV2I	GAAGAC	1 cut(s)	779
BsuRI	GGCC	1 cut(s)	221
BtgZI	GCGATG	1 cut(s)	1065
BtsCI	GGATG	7 cut(s)	367, 559, 727, 745, 976, 1003, 1032
Cac8I	GCNNGC	3 cut(s)	226, 230, 603
Cfr10I	RCCGGY	2 cut(s)	224, 1058
CviAII	CATG	1 cut(s)	437
DdeI	CTNAG	1 cut(s)	864
DpnI	GATC	2 cut(s)	275, 687
DpnII	GATC	2 cut(s)	273, 685
Eam1104I	CTCTTC	3 cut(s)	449, 806, 911
EarI	CTCTTC	3 cut(s)	449, 806, 911
Eco24I	GRGCYC	3 cut(s)	261, 369, 808
Eco57I	CTGAAG	1 cut(s)	830
EcoT38I	GRGCYC	3 cut(s)	261, 369, 808
FaeI	CATG	1 cut(s)	440
FalI	AAGNNNNNCTT	2 cut(s)	399, 431
FatI	CATG	1 cut(s)	436
FauI	CCCGC	2 cut(s)	594, 598
FauNDI	CATATG	1 cut(s)	270
Fnu4HI	GCNGC	4 cut(s)	222, 243, 434, 819
FokI	GGATG	7 cut(s)	374, 566, 734, 752, 983, 1010, 1039
FriOI	GRGCYC	3 cut(s)	261, 369, 808
Fsp4HI	GCNGC	4 cut(s)	222, 243, 434, 819
GluI	GCNGC	4 cut(s)	222, 243, 434, 819
HaeIII	GGCC	1 cut(s)	221
HapII	CCGG	2 cut(s)	225, 1059
Hin1II	CATG	1 cut(s)	440
HindIII	AAGCTT	1 cut(s)	413
HinfI	GANTC	6 cut(s)	421, 463, 473, 725, 824, 1079
HpaII	CCGG	2 cut(s)	225, 1059
HphI	GGTGA	3 cut(s)	508, 809, 998
Hpy188I	TCNGA	7 cut(s)	58, 621, 690, 721, 730, 810, 1084
Hpy188III	TCNNGA	1 cut(s)	235
Hpy99I	CGWCG	1 cut(s)	253
HpyAV	CCTTC	3 cut(s)	566, 853, 862
HpyCH4III	ACNGT	2 cut(s)	778, 905
HpyCH4V	TGCA	4 cut(s)	167, 436, 656, 961
HpyF10VI	GCNNNNNNNGC	1 cut(s)	265
HpyF3I	CTNAG	1 cut(s)	864
Hsp92II	CATG	1 cut(s)	440
KroI	GCCGGC	1 cut(s)	224
KroNI	GCCGGC	1 cut(s)	226
Kzo9I	GATC	2 cut(s)	273, 685
LmnI	GCTCC	2 cut(s)	1047, 1072
Lsp1109I	GCAGC	2 cut(s)	420, 805
LweI	GCATC	2 cut(s)	1075, 1081
MaeIII	GTNAC	1 cut(s)	205
MalI	GATC	2 cut(s)	275, 687
MboI	GATC	2 cut(s)	273, 685
MboII	GAAGA	6 cut(s)	337, 466, 535, 784, 823, 928
MfeI	CAATTG	1 cut(s)	1036
MhlI	GDGCHC	3 cut(s)	261, 369, 808
MluCI	AATT	9 cut(s)	17, 39, 121, 168, 468, 500, 577, 1005, 1036
MluI	ACGCGT	1 cut(s)	294
MlyI	GAGTC	3 cut(s)	472, 482, 1073
MroNI	GCCGGC	1 cut(s)	224
MseI	TTAA	2 cut(s)	300, 429
MspI	CCGG	2 cut(s)	225, 1059
MunI	CAATTG	1 cut(s)	1036
Mva1269I	GAATGC	1 cut(s)	547
MvnI	CGCG	1 cut(s)	296
MwoI	GCNNNNNNNGC	1 cut(s)	265
NaeI	GCCGGC	1 cut(s)	226
NdeI	CATATG	1 cut(s)	270
NdeII	GATC	2 cut(s)	273, 685
NgoMIV	GCCGGC	1 cut(s)	224
NlaIII	CATG	1 cut(s)	440
NlaIV	GGNNCC	1 cut(s)	138
NmuCI	GTSAC	1 cut(s)	205
PcsI	WCGNNNNNNNCGW	1 cut(s)	245
PctI	GAATGC	1 cut(s)	547
PdiI	GCCGGC	1 cut(s)	226
PfeI	GAWTC	3 cut(s)	421, 725, 824
PflFI	GACNNNGTC	1 cut(s)	93
PflMI	CCANNNNNTGG	1 cut(s)	644
PkrI	GCNGC	4 cut(s)	223, 244, 435, 820
PleI	GAGTC	3 cut(s)	471, 481, 1073
PpsI	GAGTC	3 cut(s)	471, 481, 1073
PspN4I	GGNNCC	1 cut(s)	138
PsyI	GACNNNGTC	1 cut(s)	93
SaqAI	TTAA	2 cut(s)	300, 429
SatI	GCNGC	4 cut(s)	222, 243, 434, 819
Sau3AI	GATC	2 cut(s)	273, 685
SchI	GAGTC	3 cut(s)	472, 482, 1073
SduI	GDGCHC	3 cut(s)	261, 369, 808
SfaNI	GCATC	2 cut(s)	1075, 1081
SmlI	CTYRAG	2 cut(s)	233, 312
SmoI	CTYRAG	2 cut(s)	233, 312
Sse9I	AATT	9 cut(s)	17, 39, 121, 168, 468, 500, 577, 1005, 1036
SsiI	CCGC	8 cut(s)	222, 242, 289, 601, 605, 821, 881, 1045
TaaI	ACNGT	2 cut(s)	778, 905
TaqI	TCGA	2 cut(s)	107, 216
TasI	AATT	9 cut(s)	17, 39, 121, 168, 468, 500, 577, 1005, 1036
TauI	GCSGC	2 cut(s)	224, 245
TfiI	GAWTC	3 cut(s)	421, 725, 824
Tru1I	TTAA	2 cut(s)	300, 429
Tru9I	TTAA	2 cut(s)	300, 429
TseFI	GTSAC	1 cut(s)	205
TseI	GCWGC	2 cut(s)	433, 818
Tsp45I	GTSAC	1 cut(s)	205
TspDTI	ATGAA	6 cut(s)	73, 434, 536, 611, 1043, 1089
Tth111I	GACNNNGTC	1 cut(s)	93
Van91I	CCANNNNNTGG	1 cut(s)	644
XapI	RAATTY	1 cut(s)	17

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.