Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005127.1

Orthogroup ID

OG0008708

Physical Location & Seq

Genomic Coordinates Forward (+)

556 .. 882

Gene Structure 327 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005127.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 327 bp

atgcagatgactatgatggctacacctaacatgaacaaggagctgcattacctcaacaaggaagatcggttgctacgctggctcttggttaaacaccgagacacaaagtatggcatggaatttcttagcgaacaggataccagaaatgaaattaataagtttcaacggggcagcatatatgatatggttgaagatgacgacgatgacgacgacgatgacgatgatgaatatgatgtggaccgggaaggaaataatatggctgaagacgacaacgacgacgacgatgaatatgatgtggaccaggaaggaaagcagattgatggatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_S6

Protein Analysis

108

Amino Acids

12.94

Weight (kDa)

4.05

Isoelectric Point (pI)

43.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008708)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G18760 AT3G18760
fragaria_vesca	FvH4_1g01540 FvH4_1g01540 FvH4_1g01540 FvH4_1g01540
malus_domestica	MD02G1012200.v1.1 MD15G1158000.v1.1
prunus_persica	Prupe.3G048400_v2.0.a1 Prupe.7G253200_v2.0.a1 Prupe.7G253200_v2.0.a1 Prupe.7G253200_v2.0.a1
pyrus_communis	pycom02g01140 pycom15g14180
rosa_chinensis	RchiOBHm_Chr2g0086501
rosa_multiflora	Rmu_sc0005127.1_g000001 Rmu_sc0012559.1_g000003
rosa_roxburghii	Rroxscaffold_2G00154510
rosa_rugosa	Rorug01G0467500
rosa_samantha	Rh2AG018300 Rh2CG018700 Rh2DG019600
rosa_wichuraiana	Rw2G001530

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	119
AcuI	CTGAAG	1 cut(s)	282
AfiI	CCNNNNNNNGG	1 cut(s)	58
AgsI	TTSAA	2 cut(s)	164, 191
AjnI	CCWGG	1 cut(s)	300
AluBI	AGCT	1 cut(s)	43
AluI	AGCT	1 cut(s)	43
Alw26I	GTCTC	1 cut(s)	93
ApeKI	GCWGC	2 cut(s)	43, 171
ApoI	RAATTY	1 cut(s)	119
AseI	ATTAAT	1 cut(s)	153
AspS9I	GGNCC	2 cut(s)	238, 298
AsuC2I	CCSGG	1 cut(s)	242
AvaII	GGWCC	2 cut(s)	238, 298
BbsI	GAAGAC	1 cut(s)	270
BbvI	GCAGC	2 cut(s)	30, 183
BccI	CCATC	2 cut(s)	10, 314
BciT130I	CCWGG	1 cut(s)	302
BciVI	GTATCC	1 cut(s)	130
BcnI	CCSGG	1 cut(s)	242
BcoDI	GTCTC	1 cut(s)	93
BfuI	GTATCC	1 cut(s)	130
BisI	GCNGC	2 cut(s)	44, 172
BlsI	GCNGC	2 cut(s)	45, 173
Bme1390I	CCNGG	2 cut(s)	242, 302
Bme18I	GGWCC	2 cut(s)	238, 298
BmgT120I	GGNCC	2 cut(s)	238, 298
BmrFI	CCNGG	2 cut(s)	242, 302
BpiI	GAAGAC	1 cut(s)	270
BpuMI	CCSGG	1 cut(s)	242
Bsc4I	CCNNNNNNNGG	1 cut(s)	58
BseBI	CCWGG	1 cut(s)	302
BseLI	CCNNNNNNNGG	1 cut(s)	58
BseXI	GCAGC	2 cut(s)	30, 183
BsiSI	CCGG	1 cut(s)	241
BslI	CCNNNNNNNGG	1 cut(s)	58
BsmAI	GTCTC	1 cut(s)	93
Bsp143I	GATC	1 cut(s)	64
BssMI	GATC	1 cut(s)	64
Bst2UI	CCWGG	1 cut(s)	302
BstC8I	GCNNGC	1 cut(s)	80
BstDEI	CTNAG	1 cut(s)	125
BstENI	CCTNNNNNAGG	1 cut(s)	56
BstKTI	GATC	1 cut(s)	67
BstMAI	GTCTC	1 cut(s)	93
BstMBI	GATC	1 cut(s)	64
BstMWI	GCNNNNNNNGC	1 cut(s)	79
BstNI	CCWGG	1 cut(s)	302
BstSCI	CCNGG	2 cut(s)	240, 300
BstV1I	GCAGC	2 cut(s)	30, 183
BstV2I	GAAGAC	1 cut(s)	270
BsuI	GTATCC	1 cut(s)	130
Cac8I	GCNNGC	1 cut(s)	80
Cfr13I	GGNCC	2 cut(s)	238, 298
CviAII	CATG	2 cut(s)	31, 115
CviJI	RGCY	4 cut(s)	20, 43, 82, 260
CviKI_1	RGCY	4 cut(s)	20, 43, 82, 260
DdeI	CTNAG	1 cut(s)	125
DpnI	GATC	1 cut(s)	66
DpnII	GATC	1 cut(s)	64
Eco47I	GGWCC	2 cut(s)	238, 298
Eco57I	CTGAAG	1 cut(s)	282
EcoNI	CCTNNNNNAGG	1 cut(s)	56
EcoRII	CCWGG	1 cut(s)	300
FaeI	CATG	2 cut(s)	34, 118
FatI	CATG	2 cut(s)	30, 114
Fnu4HI	GCNGC	2 cut(s)	44, 172
Fsp4HI	GCNGC	2 cut(s)	44, 172
GluI	GCNGC	2 cut(s)	44, 172
HapII	CCGG	1 cut(s)	241
Hin1II	CATG	2 cut(s)	34, 118
HpaII	CCGG	1 cut(s)	241
Hpy166II	GTNNAC	2 cut(s)	238, 298
Hpy8I	GTNNAC	2 cut(s)	238, 298
Hpy99I	CGWCG	6 cut(s)	203, 212, 215, 278, 281, 284
HpyAV	CCTTC	2 cut(s)	239, 299
HpyCH4V	TGCA	2 cut(s)	4, 46
HpyF10VI	GCNNNNNNNGC	1 cut(s)	79
HpyF3I	CTNAG	1 cut(s)	125
Hsp92II	CATG	2 cut(s)	34, 118
Kzo9I	GATC	1 cut(s)	64
LmnI	GCTCC	1 cut(s)	40
LpnPI	CCDG	6 cut(s)	64, 119, 154, 254, 287, 314
Lsp1109I	GCAGC	2 cut(s)	30, 183
MalI	GATC	1 cut(s)	66
MboI	GATC	1 cut(s)	64
MboII	GAAGA	3 cut(s)	74, 203, 275
MluCI	AATT	2 cut(s)	119, 150
MnlI	CCTC	1 cut(s)	62
MseI	TTAA	2 cut(s)	90, 153
MspI	CCGG	1 cut(s)	241
MspR9I	CCNGG	2 cut(s)	242, 302
MvaI	CCWGG	1 cut(s)	302
MwoI	GCNNNNNNNGC	1 cut(s)	79
NciI	CCSGG	1 cut(s)	242
NdeII	GATC	1 cut(s)	64
NlaIII	CATG	2 cut(s)	34, 118
PcsI	WCGNNNNNNNCGW	5 cut(s)	204, 207, 216, 273, 279
PkrI	GCNGC	2 cut(s)	45, 173
PshBI	ATTAAT	1 cut(s)	153
Psp6I	CCWGG	1 cut(s)	300
PspGI	CCWGG	1 cut(s)	300
PspPI	GGNCC	2 cut(s)	238, 298
SaqAI	TTAA	2 cut(s)	90, 153
SatI	GCNGC	2 cut(s)	44, 172
Sau3AI	GATC	1 cut(s)	64
Sau96I	GGNCC	2 cut(s)	238, 298
ScrFI	CCNGG	2 cut(s)	242, 302
SetI	ASST	3 cut(s)	28, 45, 54
SinI	GGWCC	2 cut(s)	238, 298
Sse9I	AATT	2 cut(s)	119, 150
StyD4I	CCNGG	2 cut(s)	240, 300
TasI	AATT	2 cut(s)	119, 150
Tru1I	TTAA	2 cut(s)	90, 153
Tru9I	TTAA	2 cut(s)	90, 153
TseI	GCWGC	2 cut(s)	43, 171
TspDTI	ATGAA	4 cut(s)	47, 162, 240, 300
VpaK11BI	GGWCC	2 cut(s)	238, 298
VspI	ATTAAT	1 cut(s)	153
XagI	CCTNNNNNAGG	1 cut(s)	56
XapI	RAATTY	1 cut(s)	119

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.